Incidental Mutation 'R0590:Kcnh5'
ID 55937
Institutional Source Beutler Lab
Gene Symbol Kcnh5
Ensembl Gene ENSMUSG00000034402
Gene Name potassium voltage-gated channel, subfamily H (eag-related), member 5
Synonyms
MMRRC Submission 038780-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0590 (G1)
Quality Score 168
Status Validated
Chromosome 12
Chromosomal Location 74943994-75224106 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 75012035 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Aspartic acid at position 628 (A628D)
Ref Sequence ENSEMBL: ENSMUSP00000046864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042299]
AlphaFold Q920E3
Predicted Effect probably damaging
Transcript: ENSMUST00000042299
AA Change: A628D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046864
Gene: ENSMUSG00000034402
AA Change: A628D

DomainStartEndE-ValueType
PAS 14 86 8.97e0 SMART
PAC 92 134 6.64e-7 SMART
Pfam:Ion_trans 214 479 1.2e-37 PFAM
Pfam:Ion_trans_2 390 473 5e-14 PFAM
cNMP 550 668 2.48e-15 SMART
low complexity region 710 717 N/A INTRINSIC
coiled coil region 907 944 N/A INTRINSIC
low complexity region 953 968 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of voltage-gated potassium channels. Members of this family have diverse functions, including regulating neurotransmitter and hormone release, cardiac function, and cell volume. This protein is an outward-rectifying, noninactivating channel. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a targeted gene disruption display thigmotaxis and abnormal startle reflex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acnat2 C T 4: 49,383,273 (GRCm39) M93I probably benign Het
Adamts16 T C 13: 70,949,073 (GRCm39) D196G probably benign Het
Adhfe1 T A 1: 9,618,378 (GRCm39) probably null Het
AI661453 A G 17: 47,777,999 (GRCm39) probably benign Het
Apc G T 18: 34,449,283 (GRCm39) E2026* probably null Het
Atg2a GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC 19: 6,295,037 (GRCm39) probably benign Het
Cad T C 5: 31,219,575 (GRCm39) S688P probably damaging Het
Ccdc191 C T 16: 43,751,704 (GRCm39) R345* probably null Het
Dcaf13 T A 15: 39,008,480 (GRCm39) probably benign Het
Drc1 A G 5: 30,520,480 (GRCm39) D607G probably benign Het
Fhip1a T C 3: 85,579,683 (GRCm39) R841G probably benign Het
Gli1 G T 10: 127,167,432 (GRCm39) A607E possibly damaging Het
Gls G A 1: 52,251,534 (GRCm39) probably benign Het
Gria1 A T 11: 57,180,235 (GRCm39) Q728H probably damaging Het
Hcrtr1 A G 4: 130,029,487 (GRCm39) L198P probably damaging Het
Ifngr1 T A 10: 19,479,690 (GRCm39) probably benign Het
Ipo5 T C 14: 121,181,769 (GRCm39) V954A possibly damaging Het
Kif14 T C 1: 136,410,210 (GRCm39) S646P probably damaging Het
Ksr1 A G 11: 78,935,966 (GRCm39) S133P probably damaging Het
Neb T C 2: 52,027,302 (GRCm39) M7143V probably damaging Het
Nelfa G A 5: 34,059,169 (GRCm39) P229S probably damaging Het
Nfatc2 T C 2: 168,413,119 (GRCm39) T169A probably damaging Het
Nr1h4 A G 10: 89,292,429 (GRCm39) Y398H probably damaging Het
Nrcam A G 12: 44,610,815 (GRCm39) E511G probably damaging Het
Ocstamp T A 2: 165,239,671 (GRCm39) R172W probably damaging Het
Or10ag60 A G 2: 87,438,338 (GRCm39) E202G probably damaging Het
Or8d1 T A 9: 38,766,766 (GRCm39) M136K probably damaging Het
Or8g19 T C 9: 39,056,017 (GRCm39) V207A probably benign Het
Phf14 G A 6: 11,961,577 (GRCm39) V405I possibly damaging Het
Plk5 G A 10: 80,196,057 (GRCm39) R238H probably damaging Het
Pole A G 5: 110,465,792 (GRCm39) E1240G probably benign Het
Prdm15 A G 16: 97,598,961 (GRCm39) I899T possibly damaging Het
Psip1 T C 4: 83,376,381 (GRCm39) N486S probably benign Het
Rlf A G 4: 121,028,030 (GRCm39) probably benign Het
Rttn T C 18: 88,997,759 (GRCm39) S255P probably damaging Het
Rusf1 A G 7: 127,896,642 (GRCm39) L134P probably damaging Het
Sema6c A G 3: 95,079,934 (GRCm39) K711E probably damaging Het
Slc4a10 A T 2: 62,021,237 (GRCm39) probably benign Het
Trim36 T G 18: 46,305,643 (GRCm39) S435R probably benign Het
Ucp1 A G 8: 84,018,232 (GRCm39) probably benign Het
Vmn1r17 T C 6: 57,337,999 (GRCm39) Y122C probably benign Het
Vmn1r23 A G 6: 57,903,349 (GRCm39) V143A probably benign Het
Wdfy4 T A 14: 32,763,131 (GRCm39) Q2166L probably benign Het
Zc3h7b C T 15: 81,661,199 (GRCm39) T346M possibly damaging Het
Zfhx4 T A 3: 5,467,693 (GRCm39) V2617D probably damaging Het
Other mutations in Kcnh5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Kcnh5 APN 12 74,944,570 (GRCm39) missense probably benign 0.00
IGL00675:Kcnh5 APN 12 75,160,963 (GRCm39) critical splice donor site probably null
IGL00688:Kcnh5 APN 12 74,945,171 (GRCm39) missense probably benign 0.01
IGL00721:Kcnh5 APN 12 75,054,450 (GRCm39) missense probably benign 0.32
IGL00793:Kcnh5 APN 12 75,161,120 (GRCm39) missense probably damaging 0.99
IGL00802:Kcnh5 APN 12 75,054,399 (GRCm39) missense possibly damaging 0.62
IGL00920:Kcnh5 APN 12 75,023,267 (GRCm39) missense probably damaging 1.00
IGL01595:Kcnh5 APN 12 74,945,101 (GRCm39) missense probably benign 0.05
IGL01642:Kcnh5 APN 12 75,011,943 (GRCm39) missense probably damaging 0.98
IGL01675:Kcnh5 APN 12 75,161,274 (GRCm39) nonsense probably null
IGL01733:Kcnh5 APN 12 75,011,966 (GRCm39) missense probably benign 0.02
IGL02006:Kcnh5 APN 12 74,944,322 (GRCm39) missense probably damaging 0.99
IGL02075:Kcnh5 APN 12 75,134,379 (GRCm39) missense probably benign 0.00
IGL02148:Kcnh5 APN 12 74,944,426 (GRCm39) missense possibly damaging 0.86
IGL02155:Kcnh5 APN 12 75,223,312 (GRCm39) utr 5 prime probably benign
IGL02304:Kcnh5 APN 12 75,023,471 (GRCm39) missense probably benign 0.01
IGL02957:Kcnh5 APN 12 75,054,439 (GRCm39) missense probably benign 0.01
R0305:Kcnh5 UTSW 12 75,161,171 (GRCm39) missense probably benign 0.00
R0470:Kcnh5 UTSW 12 75,161,188 (GRCm39) missense probably benign 0.22
R0553:Kcnh5 UTSW 12 75,184,447 (GRCm39) missense probably benign 0.00
R0557:Kcnh5 UTSW 12 75,161,323 (GRCm39) missense probably damaging 1.00
R0697:Kcnh5 UTSW 12 75,023,305 (GRCm39) missense possibly damaging 0.80
R0699:Kcnh5 UTSW 12 75,023,305 (GRCm39) missense possibly damaging 0.80
R1512:Kcnh5 UTSW 12 75,166,711 (GRCm39) missense probably benign
R1728:Kcnh5 UTSW 12 75,184,465 (GRCm39) missense probably benign 0.18
R1739:Kcnh5 UTSW 12 75,161,003 (GRCm39) missense probably damaging 1.00
R1784:Kcnh5 UTSW 12 75,184,465 (GRCm39) missense probably benign 0.18
R1956:Kcnh5 UTSW 12 74,944,358 (GRCm39) missense probably benign 0.01
R1957:Kcnh5 UTSW 12 74,944,358 (GRCm39) missense probably benign 0.01
R2155:Kcnh5 UTSW 12 74,945,230 (GRCm39) critical splice acceptor site probably null
R2185:Kcnh5 UTSW 12 75,177,705 (GRCm39) missense possibly damaging 0.95
R2237:Kcnh5 UTSW 12 75,054,493 (GRCm39) missense probably benign 0.00
R2239:Kcnh5 UTSW 12 75,054,493 (GRCm39) missense probably benign 0.00
R2483:Kcnh5 UTSW 12 75,161,245 (GRCm39) missense probably damaging 1.00
R2655:Kcnh5 UTSW 12 75,161,314 (GRCm39) missense probably damaging 1.00
R3767:Kcnh5 UTSW 12 75,134,350 (GRCm39) missense possibly damaging 0.81
R3835:Kcnh5 UTSW 12 74,945,044 (GRCm39) missense probably benign
R4681:Kcnh5 UTSW 12 75,054,397 (GRCm39) missense probably benign 0.00
R4728:Kcnh5 UTSW 12 75,054,555 (GRCm39) missense probably damaging 1.00
R4965:Kcnh5 UTSW 12 75,011,925 (GRCm39) missense probably benign 0.11
R5127:Kcnh5 UTSW 12 74,944,858 (GRCm39) missense probably benign 0.17
R5267:Kcnh5 UTSW 12 75,134,190 (GRCm39) missense probably damaging 0.98
R5535:Kcnh5 UTSW 12 75,177,681 (GRCm39) missense possibly damaging 0.76
R5590:Kcnh5 UTSW 12 75,023,463 (GRCm39) missense probably benign 0.05
R5684:Kcnh5 UTSW 12 75,184,423 (GRCm39) missense probably damaging 1.00
R5747:Kcnh5 UTSW 12 74,945,194 (GRCm39) missense probably benign 0.04
R6123:Kcnh5 UTSW 12 75,134,365 (GRCm39) missense probably benign 0.01
R6545:Kcnh5 UTSW 12 75,054,432 (GRCm39) missense probably damaging 1.00
R6662:Kcnh5 UTSW 12 75,054,385 (GRCm39) missense probably damaging 1.00
R7117:Kcnh5 UTSW 12 75,161,219 (GRCm39) missense possibly damaging 0.87
R7161:Kcnh5 UTSW 12 74,944,483 (GRCm39) missense probably benign 0.10
R7437:Kcnh5 UTSW 12 75,184,417 (GRCm39) critical splice donor site probably null
R7557:Kcnh5 UTSW 12 75,054,399 (GRCm39) missense possibly damaging 0.62
R7566:Kcnh5 UTSW 12 75,161,166 (GRCm39) nonsense probably null
R7591:Kcnh5 UTSW 12 75,054,541 (GRCm39) missense probably benign 0.24
R7781:Kcnh5 UTSW 12 75,023,455 (GRCm39) missense probably damaging 0.99
R7816:Kcnh5 UTSW 12 75,023,457 (GRCm39) missense probably damaging 1.00
R8152:Kcnh5 UTSW 12 74,944,633 (GRCm39) missense possibly damaging 0.68
R8390:Kcnh5 UTSW 12 75,134,532 (GRCm39) missense probably damaging 1.00
R8560:Kcnh5 UTSW 12 75,023,379 (GRCm39) missense probably damaging 1.00
R9056:Kcnh5 UTSW 12 74,944,774 (GRCm39) missense probably benign 0.00
R9064:Kcnh5 UTSW 12 75,177,727 (GRCm39) nonsense probably null
R9283:Kcnh5 UTSW 12 75,023,307 (GRCm39) missense probably damaging 1.00
R9290:Kcnh5 UTSW 12 75,023,488 (GRCm39) missense probably benign 0.00
R9552:Kcnh5 UTSW 12 75,023,334 (GRCm39) missense probably benign 0.28
R9576:Kcnh5 UTSW 12 74,944,307 (GRCm39) missense probably benign 0.00
R9627:Kcnh5 UTSW 12 75,160,990 (GRCm39) missense probably damaging 0.99
R9645:Kcnh5 UTSW 12 75,134,191 (GRCm39) missense probably benign 0.32
R9650:Kcnh5 UTSW 12 75,023,293 (GRCm39) missense probably benign 0.32
Z1088:Kcnh5 UTSW 12 75,012,069 (GRCm39) missense possibly damaging 0.78
Z1088:Kcnh5 UTSW 12 74,944,535 (GRCm39) missense probably benign 0.00
Z1177:Kcnh5 UTSW 12 75,161,296 (GRCm39) missense probably damaging 1.00
Z1177:Kcnh5 UTSW 12 75,054,571 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TTCTTGGCTGATAGAACATAGCCTGC -3'
(R):5'- GTCCTCATGATGAAAATGTGCTGTGC -3'

Sequencing Primer
(F):5'- CTAGCCCCCTGGATACTCATAAG -3'
(R):5'- GATGAAAATGTGCTGTGCAATATTAC -3'
Posted On 2013-07-11