Incidental Mutation 'R7187:Brf1'
ID 559376
Institutional Source Beutler Lab
Gene Symbol Brf1
Ensembl Gene ENSMUSG00000011158
Gene Name BRF1, RNA polymerase III transcription initiation factor 90 kDa subunit
Synonyms GTF3B, 2510002F24Rik, TAFIII90, TFIIIB90, TAF3C
MMRRC Submission
Accession Numbers

Genbank: NM_028193; MGI: 1919558

Is this an essential gene? Probably essential (E-score: 0.972) question?
Stock # R7187 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 112960085-113000704 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 112960325 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 676 (Y676C)
Ref Sequence ENSEMBL: ENSMUSP00000011302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011302]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000011302
AA Change: Y676C
SMART Domains Protein: ENSMUSP00000011302
Gene: ENSMUSG00000011158
AA Change: Y676C

DomainStartEndE-ValueType
Pfam:TF_Zn_Ribbon 4 46 4.3e-17 PFAM
CYCLIN 91 172 1.93e-12 SMART
CYCLIN 185 269 1.22e-9 SMART
coiled coil region 298 334 N/A INTRINSIC
low complexity region 362 374 N/A INTRINSIC
low complexity region 431 444 N/A INTRINSIC
Pfam:BRF1 452 545 3.3e-29 PFAM
low complexity region 638 650 N/A INTRINSIC
low complexity region 662 675 N/A INTRINSIC
Meta Mutation Damage Score 0.1651 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three subunits of the RNA polymerase III transcription factor complex. This complex plays a central role in transcription initiation by RNA polymerase III on genes encoding tRNA, 5S rRNA, and other small structural RNAs. The gene product belongs to the TF2B family. Several alternatively spliced variants encoding different isoforms, that function at different promoters transcribed by RNA polymerase III, have been identified. [provided by RefSeq, Jun 2011]
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 A G 2: 25,437,721 Y716C probably damaging Het
Abcc1 A G 16: 14,466,997 I1237V probably benign Het
Adam34 C T 8: 43,652,528 A27T probably benign Het
Aff3 T C 1: 38,218,397 S415G probably damaging Het
Ak7 T C 12: 105,745,273 Y390H probably benign Het
Arap2 A C 5: 62,669,053 M1056R probably damaging Het
Cachd1 T A 4: 100,976,355 H776Q possibly damaging Het
Cacng7 T C 7: 3,336,667 V28A probably damaging Het
Camk2g A T 14: 20,742,712 D359E probably benign Het
Cd209b T C 8: 3,926,638 D16G probably benign Het
Ceacam5 A G 7: 17,759,485 E811G possibly damaging Het
Cecr2 T A 6: 120,756,686 S545T probably benign Het
Cep55 T C 19: 38,060,358 probably null Het
Ctif C A 18: 75,637,219 V32L probably damaging Het
Cwc27 G A 13: 104,661,392 A353V probably benign Het
Dclk3 T A 9: 111,484,996 S713R probably damaging Het
Dlec1 C T 9: 119,112,146 H255Y probably benign Het
Dlgap1 A G 17: 70,516,098 H26R possibly damaging Het
Dydc1 C T 14: 41,078,094 T19I possibly damaging Het
Efcab12 G A 6: 115,823,513 P183L not run Het
Eri3 C A 4: 117,589,146 Q219K probably benign Het
Fam135a A G 1: 24,044,214 L310P probably damaging Het
Fgd5 T A 6: 91,988,291 S502T possibly damaging Het
Fgf8 A G 19: 45,741,667 S57P probably benign Het
Gls T C 1: 52,219,980 E154G probably damaging Het
Gm21319 T C 12: 87,773,938 probably benign Het
Gm28042 T C 2: 120,039,695 L705P probably damaging Het
Golgb1 C A 16: 36,916,150 Q1961K probably benign Het
Herc3 C A 6: 58,856,631 Q168K probably benign Het
Il31ra C A 13: 112,546,311 C168F probably benign Het
Ino80 A T 2: 119,426,591 D860E probably benign Het
Iqcm T G 8: 75,753,416 L334R probably benign Het
Lrrk2 A G 15: 91,757,001 D1587G possibly damaging Het
Map4 T A 9: 110,053,133 V355E probably benign Het
Mapk13 T A 17: 28,776,387 I194N probably damaging Het
Mtus2 A G 5: 148,076,705 T103A probably benign Het
Naglu G T 11: 101,070,332 G70W probably benign Het
Nlrp4f A T 13: 65,195,387 M126K possibly damaging Het
Olfr1225 T C 2: 89,171,370 probably benign Het
Olfr485 A T 7: 108,159,378 V165E probably benign Het
Pdia4 T C 6: 47,813,259 T16A unknown Het
Pou6f2 G A 13: 18,239,713 A159V Het
Ripor1 A G 8: 105,617,874 T547A probably benign Het
Rundc3b A G 5: 8,492,506 S389P probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spats2 T C 15: 99,212,173 S484P probably benign Het
Supv3l1 G A 10: 62,435,549 T403I probably damaging Het
Tacstd2 G A 6: 67,535,196 R171W probably damaging Het
Taok2 A T 7: 126,872,380 F542L probably damaging Het
Tbc1d31 T A 15: 57,938,063 N331K possibly damaging Het
Tff2 A T 17: 31,142,226 C118S probably damaging Het
Tmprss7 G A 16: 45,677,954 T354I possibly damaging Het
Tmtc3 A T 10: 100,477,912 F33I probably damaging Het
Tpbpa G A 13: 60,940,585 probably benign Het
Ube3a G T 7: 59,275,905 V165F probably benign Het
Vmn2r4 T G 3: 64,415,260 T13P probably benign Het
Wnt8b A G 19: 44,511,682 D236G probably benign Het
Ythdf3 C A 3: 16,204,287 D210E probably benign Het
Zfp110 T A 7: 12,849,826 Y800* probably null Het
Other mutations in Brf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Brf1 APN 12 112963600 splice site probably benign
IGL01609:Brf1 APN 12 112963591 missense probably damaging 1.00
IGL01610:Brf1 APN 12 112988083 missense probably benign
IGL01622:Brf1 APN 12 112961175 missense probably benign 0.02
IGL01623:Brf1 APN 12 112961175 missense probably benign 0.02
IGL01791:Brf1 APN 12 112962475 missense probably benign 0.00
IGL02037:Brf1 APN 12 112993062 critical splice donor site probably null
IGL02227:Brf1 APN 12 112961774 missense probably damaging 1.00
R0106:Brf1 UTSW 12 112973463 unclassified probably benign
R0106:Brf1 UTSW 12 112973463 unclassified probably benign
R0138:Brf1 UTSW 12 112961139 missense probably damaging 0.99
R1345:Brf1 UTSW 12 112961108 critical splice donor site probably null
R1370:Brf1 UTSW 12 112961108 critical splice donor site probably null
R1927:Brf1 UTSW 12 113000344 missense possibly damaging 0.95
R2423:Brf1 UTSW 12 113000199 missense probably benign 0.17
R3608:Brf1 UTSW 12 112961274 missense probably benign 0.00
R3703:Brf1 UTSW 12 112969371 splice site probably null
R4033:Brf1 UTSW 12 112979732 missense probably damaging 1.00
R4817:Brf1 UTSW 12 112972301 missense probably damaging 0.99
R4897:Brf1 UTSW 12 112965887 missense probably benign 0.05
R4985:Brf1 UTSW 12 112969370 splice site probably null
R5092:Brf1 UTSW 12 112979732 missense probably damaging 1.00
R7138:Brf1 UTSW 12 112970215 missense probably damaging 1.00
R7726:Brf1 UTSW 12 112964245 missense probably benign
R7970:Brf1 UTSW 12 112964200 missense probably damaging 1.00
R8719:Brf1 UTSW 12 112979684 critical splice donor site probably benign
R8897:Brf1 UTSW 12 112987969 missense probably damaging 1.00
R8967:Brf1 UTSW 12 112973619 missense probably damaging 1.00
R9109:Brf1 UTSW 12 112963391 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCACAATGTAGCCACAGG -3'
(R):5'- TAGCCATACTATTTGTAGTGCCCAG -3'

Sequencing Primer
(F):5'- ATGTAGCCACAGGAAGAGAGCTTC -3'
(R):5'- ACTATTTGTAGTGCCCAGCAAGG -3'
Posted On 2019-06-26