Incidental Mutation 'R7187:Il31ra'
ID559380
Institutional Source Beutler Lab
Gene Symbol Il31ra
Ensembl Gene ENSMUSG00000050377
Gene Nameinterleukin 31 receptor A
SynonymsGLM-R, GPL
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7187 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location112519898-112594360 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 112546311 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 168 (C168F)
Ref Sequence ENSEMBL: ENSMUSP00000058045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051756] [ENSMUST00000223752] [ENSMUST00000223819] [ENSMUST00000224510] [ENSMUST00000224576] [ENSMUST00000225397]
Predicted Effect probably benign
Transcript: ENSMUST00000051756
AA Change: C168F

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000058045
Gene: ENSMUSG00000050377
AA Change: C168F

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
FN3 115 198 7.75e0 SMART
Blast:FN3 216 297 1e-40 BLAST
FN3 325 394 1.15e1 SMART
FN3 408 490 7.18e-3 SMART
low complexity region 508 522 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223752
Predicted Effect probably benign
Transcript: ENSMUST00000223819
AA Change: C195F

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000224510
AA Change: C87F

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000224576
Predicted Effect probably benign
Transcript: ENSMUST00000225397
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the type I cytokine receptor family. This receptor, with homology to gp130, is expressed on monocytes, and is involved in IL-31 signaling via activation of STAT-3 and STAT-5. It functions either as a monomer, or as part of a receptor complex with oncostatin M receptor (OSMR). Several alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous null mice display no apparent abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 A G 2: 25,437,721 Y716C probably damaging Het
Abcc1 A G 16: 14,466,997 I1237V probably benign Het
Adam34 C T 8: 43,652,528 A27T probably benign Het
Aff3 T C 1: 38,218,397 S415G probably damaging Het
Ak7 T C 12: 105,745,273 Y390H probably benign Het
Arap2 A C 5: 62,669,053 M1056R probably damaging Het
Brf1 T C 12: 112,960,325 Y676C unknown Het
Cachd1 T A 4: 100,976,355 H776Q possibly damaging Het
Cacng7 T C 7: 3,336,667 V28A probably damaging Het
Camk2g A T 14: 20,742,712 D359E probably benign Het
Cd209b T C 8: 3,926,638 D16G probably benign Het
Ceacam5 A G 7: 17,759,485 E811G possibly damaging Het
Cecr2 T A 6: 120,756,686 S545T probably benign Het
Cep55 T C 19: 38,060,358 probably null Het
Ctif C A 18: 75,637,219 V32L probably damaging Het
Cwc27 G A 13: 104,661,392 A353V probably benign Het
Dclk3 T A 9: 111,484,996 S713R probably damaging Het
Dlec1 C T 9: 119,112,146 H255Y probably benign Het
Dlgap1 A G 17: 70,516,098 H26R possibly damaging Het
Dydc1 C T 14: 41,078,094 T19I possibly damaging Het
Efcab12 G A 6: 115,823,513 P183L not run Het
Eri3 C A 4: 117,589,146 Q219K probably benign Het
Fam135a A G 1: 24,044,214 L310P probably damaging Het
Fgd5 T A 6: 91,988,291 S502T possibly damaging Het
Fgf8 A G 19: 45,741,667 S57P probably benign Het
Gls T C 1: 52,219,980 E154G probably damaging Het
Gm21319 T C 12: 87,773,938 probably benign Het
Gm28042 T C 2: 120,039,695 L705P probably damaging Het
Golgb1 C A 16: 36,916,150 Q1961K probably benign Het
Herc3 C A 6: 58,856,631 Q168K probably benign Het
Ino80 A T 2: 119,426,591 D860E probably benign Het
Iqcm T G 8: 75,753,416 L334R probably benign Het
Lrrk2 A G 15: 91,757,001 D1587G possibly damaging Het
Map4 T A 9: 110,053,133 V355E probably benign Het
Mapk13 T A 17: 28,776,387 I194N probably damaging Het
Mtus2 A G 5: 148,076,705 T103A probably benign Het
Naglu G T 11: 101,070,332 G70W probably benign Het
Nlrp4f A T 13: 65,195,387 M126K possibly damaging Het
Olfr1225 T C 2: 89,171,370 probably benign Het
Olfr485 A T 7: 108,159,378 V165E probably benign Het
Pdia4 T C 6: 47,813,259 T16A unknown Het
Pou6f2 G A 13: 18,239,713 A159V Het
Ripor1 A G 8: 105,617,874 T547A probably benign Het
Rundc3b A G 5: 8,492,506 S389P probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spats2 T C 15: 99,212,173 S484P probably benign Het
Supv3l1 G A 10: 62,435,549 T403I probably damaging Het
Tacstd2 G A 6: 67,535,196 R171W probably damaging Het
Taok2 A T 7: 126,872,380 F542L probably damaging Het
Tbc1d31 T A 15: 57,938,063 N331K possibly damaging Het
Tff2 A T 17: 31,142,226 C118S probably damaging Het
Tmprss7 G A 16: 45,677,954 T354I possibly damaging Het
Tmtc3 A T 10: 100,477,912 F33I probably damaging Het
Tpbpa G A 13: 60,940,585 probably benign Het
Ube3a G T 7: 59,275,905 V165F probably benign Het
Vmn2r4 T G 3: 64,415,260 T13P probably benign Het
Wnt8b A G 19: 44,511,682 D236G probably benign Het
Ythdf3 C A 3: 16,204,287 D210E probably benign Het
Zfp110 T A 7: 12,849,826 Y800* probably null Het
Other mutations in Il31ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Il31ra APN 13 112547478 missense possibly damaging 0.94
IGL00639:Il31ra APN 13 112549559 nonsense probably null
IGL01640:Il31ra APN 13 112531758 missense possibly damaging 0.58
IGL02009:Il31ra APN 13 112533867 missense probably damaging 0.98
IGL02431:Il31ra APN 13 112530296 missense probably damaging 1.00
IGL02675:Il31ra APN 13 112524352 missense probably benign 0.00
IGL02718:Il31ra APN 13 112530369 nonsense probably null
IGL03388:Il31ra APN 13 112546212 missense probably damaging 1.00
IGL03408:Il31ra APN 13 112525888 missense probably benign 0.21
R0482:Il31ra UTSW 13 112527481 missense possibly damaging 0.89
R0639:Il31ra UTSW 13 112525843 missense possibly damaging 0.95
R0905:Il31ra UTSW 13 112531673 missense probably damaging 1.00
R0948:Il31ra UTSW 13 112530378 missense possibly damaging 0.81
R1420:Il31ra UTSW 13 112531752 missense probably damaging 1.00
R1538:Il31ra UTSW 13 112547466 missense possibly damaging 0.91
R1776:Il31ra UTSW 13 112541239 missense probably damaging 0.97
R1931:Il31ra UTSW 13 112541222 missense probably damaging 1.00
R2006:Il31ra UTSW 13 112530356 missense probably damaging 1.00
R2134:Il31ra UTSW 13 112543888 missense possibly damaging 0.94
R3103:Il31ra UTSW 13 112530351 missense probably damaging 1.00
R4089:Il31ra UTSW 13 112551919 nonsense probably null
R4742:Il31ra UTSW 13 112523967 nonsense probably null
R4787:Il31ra UTSW 13 112527545 missense possibly damaging 0.82
R5154:Il31ra UTSW 13 112523997 missense possibly damaging 0.87
R5193:Il31ra UTSW 13 112524330 missense probably benign 0.34
R5402:Il31ra UTSW 13 112524135 missense probably benign 0.01
R5743:Il31ra UTSW 13 112527487 missense possibly damaging 0.89
R5917:Il31ra UTSW 13 112546312 missense probably benign
R6126:Il31ra UTSW 13 112530374 missense probably damaging 1.00
R6414:Il31ra UTSW 13 112523907 missense possibly damaging 0.90
R6580:Il31ra UTSW 13 112551942 missense possibly damaging 0.90
R6727:Il31ra UTSW 13 112547368 missense probably damaging 1.00
R6783:Il31ra UTSW 13 112551988 critical splice acceptor site probably null
R6912:Il31ra UTSW 13 112549464 missense probably damaging 0.99
R6925:Il31ra UTSW 13 112527529 missense possibly damaging 0.56
R7210:Il31ra UTSW 13 112549500 missense possibly damaging 0.95
R7236:Il31ra UTSW 13 112523905 makesense probably null
R7323:Il31ra UTSW 13 112551963 missense probably damaging 1.00
R7618:Il31ra UTSW 13 112551980 missense possibly damaging 0.66
R7783:Il31ra UTSW 13 112541251 missense probably benign
R8353:Il31ra UTSW 13 112524183 missense probably damaging 1.00
R8453:Il31ra UTSW 13 112524183 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAGGCTCAACCCAGGAAGC -3'
(R):5'- AGTGGACACTAAGTTTCTGTCAC -3'

Sequencing Primer
(F):5'- CCCTACACCAGAATAAGCAGATGAGG -3'
(R):5'- AAGTTTCTGTCACACAAACTTCC -3'
Posted On2019-06-26