Incidental Mutation 'R7187:Abcc1'
ID559386
Institutional Source Beutler Lab
Gene Symbol Abcc1
Ensembl Gene ENSMUSG00000023088
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 1
SynonymsMrp1, Mdrap, MRP, Abcc1b, Abcc1a
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R7187 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location14361558-14475737 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 14466997 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 1237 (I1237V)
Ref Sequence ENSEMBL: ENSMUSP00000097743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100167] [ENSMUST00000130671] [ENSMUST00000133454] [ENSMUST00000147759]
Predicted Effect probably benign
Transcript: ENSMUST00000100167
AA Change: I1237V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097743
Gene: ENSMUSG00000023088
AA Change: I1237V

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
low complexity region 279 290 N/A INTRINSIC
Pfam:ABC_membrane 326 597 7.8e-44 PFAM
AAA 670 845 4.07e-8 SMART
Pfam:ABC_membrane 971 1243 3e-52 PFAM
AAA 1316 1501 5.8e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130671
SMART Domains Protein: ENSMUSP00000116714
Gene: ENSMUSG00000023088

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
low complexity region 279 290 N/A INTRINSIC
Pfam:ABC_membrane 326 597 1.6e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133454
SMART Domains Protein: ENSMUSP00000122656
Gene: ENSMUSG00000023088

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
low complexity region 279 290 N/A INTRINSIC
Pfam:ABC_membrane 326 597 1.6e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147759
SMART Domains Protein: ENSMUSP00000115627
Gene: ENSMUSG00000023088

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
low complexity region 279 290 N/A INTRINSIC
Pfam:ABC_membrane 326 597 1.6e-48 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This full transporter is a member of the MRP subfamily which is involved in multi-drug resistance. This protein plays an essential role in the defense against toxic compounds and serves as the major high-affinity transporter of leukotriene C4. The encoded protein may also play an essential role in steroid hormone homeostasis as a transporter for steroid hormones and their metabolites. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene have a reduced response to inflammatory stimulus, increased levels of glutathione due to impaired metabolism, and are hypersensitive to the anticancer drug etoposide. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 A G 2: 25,437,721 Y716C probably damaging Het
Adam34 C T 8: 43,652,528 A27T probably benign Het
Aff3 T C 1: 38,218,397 S415G probably damaging Het
Ak7 T C 12: 105,745,273 Y390H probably benign Het
Arap2 A C 5: 62,669,053 M1056R probably damaging Het
Brf1 T C 12: 112,960,325 Y676C unknown Het
Cachd1 T A 4: 100,976,355 H776Q possibly damaging Het
Cacng7 T C 7: 3,336,667 V28A probably damaging Het
Camk2g A T 14: 20,742,712 D359E probably benign Het
Cd209b T C 8: 3,926,638 D16G probably benign Het
Ceacam5 A G 7: 17,759,485 E811G possibly damaging Het
Cecr2 T A 6: 120,756,686 S545T probably benign Het
Cep55 T C 19: 38,060,358 probably null Het
Ctif C A 18: 75,637,219 V32L probably damaging Het
Cwc27 G A 13: 104,661,392 A353V probably benign Het
Dclk3 T A 9: 111,484,996 S713R probably damaging Het
Dlec1 C T 9: 119,112,146 H255Y probably benign Het
Dlgap1 A G 17: 70,516,098 H26R possibly damaging Het
Dydc1 C T 14: 41,078,094 T19I possibly damaging Het
Efcab12 G A 6: 115,823,513 P183L not run Het
Eri3 C A 4: 117,589,146 Q219K probably benign Het
Fam135a A G 1: 24,044,214 L310P probably damaging Het
Fgd5 T A 6: 91,988,291 S502T possibly damaging Het
Fgf8 A G 19: 45,741,667 S57P probably benign Het
Gls T C 1: 52,219,980 E154G probably damaging Het
Gm21319 T C 12: 87,773,938 probably benign Het
Gm28042 T C 2: 120,039,695 L705P probably damaging Het
Golgb1 C A 16: 36,916,150 Q1961K probably benign Het
Herc3 C A 6: 58,856,631 Q168K probably benign Het
Il31ra C A 13: 112,546,311 C168F probably benign Het
Ino80 A T 2: 119,426,591 D860E probably benign Het
Iqcm T G 8: 75,753,416 L334R probably benign Het
Lrrk2 A G 15: 91,757,001 D1587G possibly damaging Het
Map4 T A 9: 110,053,133 V355E probably benign Het
Mapk13 T A 17: 28,776,387 I194N probably damaging Het
Mtus2 A G 5: 148,076,705 T103A probably benign Het
Naglu G T 11: 101,070,332 G70W probably benign Het
Nlrp4f A T 13: 65,195,387 M126K possibly damaging Het
Olfr1225 T C 2: 89,171,370 probably benign Het
Olfr485 A T 7: 108,159,378 V165E probably benign Het
Pdia4 T C 6: 47,813,259 T16A unknown Het
Pou6f2 G A 13: 18,239,713 A159V Het
Ripor1 A G 8: 105,617,874 T547A probably benign Het
Rundc3b A G 5: 8,492,506 S389P probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spats2 T C 15: 99,212,173 S484P probably benign Het
Supv3l1 G A 10: 62,435,549 T403I probably damaging Het
Tacstd2 G A 6: 67,535,196 R171W probably damaging Het
Taok2 A T 7: 126,872,380 F542L probably damaging Het
Tbc1d31 T A 15: 57,938,063 N331K possibly damaging Het
Tff2 A T 17: 31,142,226 C118S probably damaging Het
Tmprss7 G A 16: 45,677,954 T354I possibly damaging Het
Tmtc3 A T 10: 100,477,912 F33I probably damaging Het
Tpbpa G A 13: 60,940,585 probably benign Het
Ube3a G T 7: 59,275,905 V165F probably benign Het
Vmn2r4 T G 3: 64,415,260 T13P probably benign Het
Wnt8b A G 19: 44,511,682 D236G probably benign Het
Ythdf3 C A 3: 16,204,287 D210E probably benign Het
Zfp110 T A 7: 12,849,826 Y800* probably null Het
Other mutations in Abcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Abcc1 APN 16 14460983 missense probably benign 0.34
IGL00094:Abcc1 APN 16 14470534 missense probably null 0.00
IGL00475:Abcc1 APN 16 14436573 missense probably damaging 1.00
IGL00516:Abcc1 APN 16 14413312 nonsense probably null
IGL00765:Abcc1 APN 16 14411508 missense probably damaging 0.99
IGL00792:Abcc1 APN 16 14410926 missense probably benign 0.18
IGL01678:Abcc1 APN 16 14405019 missense probably null 0.96
IGL01683:Abcc1 APN 16 14396424 missense probably damaging 1.00
IGL01955:Abcc1 APN 16 14410795 missense probably damaging 1.00
IGL02048:Abcc1 APN 16 14411519 missense probably damaging 0.98
IGL02345:Abcc1 APN 16 14396351 missense possibly damaging 0.95
IGL02366:Abcc1 APN 16 14467979 splice site probably benign
IGL02431:Abcc1 APN 16 14419734 missense probably damaging 1.00
IGL02480:Abcc1 APN 16 14404005 missense possibly damaging 0.87
IGL02651:Abcc1 APN 16 14466126 missense probably benign 0.00
IGL02902:Abcc1 APN 16 14423127 missense probably damaging 1.00
IGL03101:Abcc1 APN 16 14389868 missense probably damaging 1.00
IGL03230:Abcc1 APN 16 14457947 missense probably benign
IGL03308:Abcc1 APN 16 14470611 missense possibly damaging 0.55
PIT4544001:Abcc1 UTSW 16 14405079 missense probably damaging 1.00
R0310:Abcc1 UTSW 16 14410927 missense probably damaging 0.98
R0594:Abcc1 UTSW 16 14389880 missense probably benign 0.05
R0894:Abcc1 UTSW 16 14465137 missense possibly damaging 0.64
R0928:Abcc1 UTSW 16 14389985 critical splice donor site probably null
R1367:Abcc1 UTSW 16 14443386 missense probably damaging 1.00
R1496:Abcc1 UTSW 16 14448434 missense probably damaging 1.00
R1643:Abcc1 UTSW 16 14413368 missense probably damaging 1.00
R1795:Abcc1 UTSW 16 14465137 missense possibly damaging 0.64
R1834:Abcc1 UTSW 16 14423117 missense possibly damaging 0.88
R1847:Abcc1 UTSW 16 14445449 missense probably benign 0.02
R1959:Abcc1 UTSW 16 14396393 missense probably damaging 1.00
R1961:Abcc1 UTSW 16 14396393 missense probably damaging 1.00
R2017:Abcc1 UTSW 16 14461204 missense probably damaging 1.00
R2224:Abcc1 UTSW 16 14472068 missense probably damaging 1.00
R2377:Abcc1 UTSW 16 14467923 missense probably damaging 0.97
R2513:Abcc1 UTSW 16 14473009 splice site probably null
R2876:Abcc1 UTSW 16 14457960 missense probably benign
R3003:Abcc1 UTSW 16 14436529 missense probably damaging 1.00
R3941:Abcc1 UTSW 16 14396399 missense probably benign 0.00
R4119:Abcc1 UTSW 16 14394013 missense probably benign 0.43
R4191:Abcc1 UTSW 16 14389864 missense probably damaging 1.00
R4369:Abcc1 UTSW 16 14460993 missense possibly damaging 0.88
R4428:Abcc1 UTSW 16 14445300 missense probably damaging 0.97
R4589:Abcc1 UTSW 16 14394031 missense probably benign 0.00
R4779:Abcc1 UTSW 16 14410771 missense probably benign 0.35
R5027:Abcc1 UTSW 16 14404053 critical splice donor site probably null
R5275:Abcc1 UTSW 16 14466186 missense probably damaging 1.00
R5418:Abcc1 UTSW 16 14461132 missense probably benign 0.02
R5490:Abcc1 UTSW 16 14410917 missense probably damaging 1.00
R5527:Abcc1 UTSW 16 14460978 missense probably benign 0.18
R5641:Abcc1 UTSW 16 14472013 missense probably benign 0.00
R5642:Abcc1 UTSW 16 14443455 missense probably damaging 1.00
R5875:Abcc1 UTSW 16 14467037 missense possibly damaging 0.94
R5916:Abcc1 UTSW 16 14465142 missense possibly damaging 0.95
R6112:Abcc1 UTSW 16 14460916 missense probably damaging 1.00
R6331:Abcc1 UTSW 16 14465056 missense probably damaging 0.97
R6464:Abcc1 UTSW 16 14447490 missense probably damaging 1.00
R6950:Abcc1 UTSW 16 14411616 missense probably damaging 1.00
R7024:Abcc1 UTSW 16 14413383 critical splice donor site probably null
R7115:Abcc1 UTSW 16 14437725 missense probably benign 0.11
R7298:Abcc1 UTSW 16 14396472 missense possibly damaging 0.89
R7342:Abcc1 UTSW 16 14465169 missense probably damaging 0.99
R7474:Abcc1 UTSW 16 14472986 missense possibly damaging 0.95
R7488:Abcc1 UTSW 16 14389899 nonsense probably null
R7583:Abcc1 UTSW 16 14404038 missense probably damaging 1.00
R7619:Abcc1 UTSW 16 14445419 missense probably damaging 0.96
R7971:Abcc1 UTSW 16 14448579 missense probably benign
R8048:Abcc1 UTSW 16 14410844 missense probably damaging 1.00
R8138:Abcc1 UTSW 16 14472887 missense probably damaging 0.99
R8159:Abcc1 UTSW 16 14472930 missense probably damaging 0.96
R8319:Abcc1 UTSW 16 14396451 missense probably damaging 1.00
X0026:Abcc1 UTSW 16 14459902 missense possibly damaging 0.94
Z1088:Abcc1 UTSW 16 14410809 missense probably benign 0.01
Z1177:Abcc1 UTSW 16 14411493 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCGTGTGGACCATGTGTC -3'
(R):5'- ATCCCAAGAGGTCCTGGAAG -3'

Sequencing Primer
(F):5'- ACCATGTGTCACCTTGGAAG -3'
(R):5'- TTAGCTCACCCTCCAAGTAGGTAGAG -3'
Posted On2019-06-26