Incidental Mutation 'R0590:Ipo5'
ID55940
Institutional Source Beutler Lab
Gene Symbol Ipo5
Ensembl Gene ENSMUSG00000030662
Gene Nameimportin 5
SynonymsRanbp5, Kpnb3, 5730478E03Rik, IMB3, 1110011C18Rik
MMRRC Submission 038780-MU
Accession Numbers

Genbank: NM_023579; MGI: 1917822

Is this an essential gene? Probably essential (E-score: 0.927) question?
Stock #R0590 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location120911224-120947999 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120944357 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 954 (V954A)
Ref Sequence ENSEMBL: ENSMUSP00000032898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032898]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032898
AA Change: V954A

PolyPhen 2 Score 0.757 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000032898
Gene: ENSMUSG00000030662
AA Change: V954A

DomainStartEndE-ValueType
low complexity region 65 72 N/A INTRINSIC
Pfam:HEAT_2 359 467 3.3e-13 PFAM
Pfam:HEAT_EZ 372 426 3.7e-10 PFAM
Pfam:Vac14_Fab1_bd 373 430 3.8e-9 PFAM
Pfam:HEAT 400 430 4.2e-7 PFAM
Pfam:HEAT 906 936 4.2e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228277
Meta Mutation Damage Score 0.4644 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleocytoplasmic transport, a signal- and energy-dependent process, takes place through nuclear pore complexes embedded in the nuclear envelope. The import of proteins containing a nuclear localization signal (NLS) requires the NLS import receptor, a heterodimer of importin alpha and beta subunits also known as karyopherins. Importin alpha binds the NLS-containing cargo in the cytoplasm and importin beta docks the complex at the cytoplasmic side of the nuclear pore complex. In the presence of nucleoside triphosphates and the small GTP binding protein Ran, the complex moves into the nuclear pore complex and the importin subunits dissociate. Importin alpha enters the nucleoplasm with its passenger protein and importin beta remains at the pore. Interactions between importin beta and the FG repeats of nucleoporins are essential in translocation through the pore complex. The protein encoded by this gene is a member of the importin beta family. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(33) : Targeted, other(2) Gene trapped(31)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acnat2 C T 4: 49,383,273 M93I probably benign Het
Adamts16 T C 13: 70,800,954 D196G probably benign Het
Adhfe1 T A 1: 9,548,153 probably null Het
AI661453 A G 17: 47,467,074 probably benign Het
Apc G T 18: 34,316,230 E2026* probably null Het
Atg2a GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC 19: 6,245,007 probably benign Het
BC017158 A G 7: 128,297,470 L134P probably damaging Het
Cad T C 5: 31,062,231 S688P probably damaging Het
Ccdc191 C T 16: 43,931,341 R345* probably null Het
Dcaf13 T A 15: 39,145,085 probably benign Het
Drc1 A G 5: 30,363,136 D607G probably benign Het
Fam160a1 T C 3: 85,672,376 R841G probably benign Het
Gli1 G T 10: 127,331,563 A607E possibly damaging Het
Gls G A 1: 52,212,375 probably benign Het
Gria1 A T 11: 57,289,409 Q728H probably damaging Het
Hcrtr1 A G 4: 130,135,694 L198P probably damaging Het
Ifngr1 T A 10: 19,603,942 probably benign Het
Kcnh5 G T 12: 74,965,261 A628D probably damaging Het
Kif14 T C 1: 136,482,472 S646P probably damaging Het
Ksr1 A G 11: 79,045,140 S133P probably damaging Het
Neb T C 2: 52,137,290 M7143V probably damaging Het
Nelfa G A 5: 33,901,825 P229S probably damaging Het
Nfatc2 T C 2: 168,571,199 T169A probably damaging Het
Nr1h4 A G 10: 89,456,567 Y398H probably damaging Het
Nrcam A G 12: 44,564,032 E511G probably damaging Het
Ocstamp T A 2: 165,397,751 R172W probably damaging Het
Olfr1130 A G 2: 87,607,994 E202G probably damaging Het
Olfr26 T A 9: 38,855,470 M136K probably damaging Het
Olfr27 T C 9: 39,144,721 V207A probably benign Het
Phf14 G A 6: 11,961,578 V405I possibly damaging Het
Plk5 G A 10: 80,360,223 R238H probably damaging Het
Pole A G 5: 110,317,926 E1240G probably benign Het
Prdm15 A G 16: 97,797,761 I899T possibly damaging Het
Psip1 T C 4: 83,458,144 N486S probably benign Het
Rlf A G 4: 121,170,833 probably benign Het
Rttn T C 18: 88,979,635 S255P probably damaging Het
Sema6c A G 3: 95,172,623 K711E probably damaging Het
Slc4a10 A T 2: 62,190,893 probably benign Het
Trim36 T G 18: 46,172,576 S435R probably benign Het
Ucp1 A G 8: 83,291,603 probably benign Het
Vmn1r17 T C 6: 57,361,014 Y122C probably benign Het
Vmn1r23 A G 6: 57,926,364 V143A probably benign Het
Wdfy4 T A 14: 33,041,174 Q2166L probably benign Het
Zc3h7b C T 15: 81,776,998 T346M possibly damaging Het
Zfhx4 T A 3: 5,402,633 V2617D probably damaging Het
Other mutations in Ipo5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01461:Ipo5 APN 14 120928533 missense probably damaging 0.98
IGL01614:Ipo5 APN 14 120935095 missense probably benign 0.01
IGL01835:Ipo5 APN 14 120926238 missense probably benign 0.24
IGL02010:Ipo5 APN 14 120933377 missense probably benign 0.20
IGL02303:Ipo5 APN 14 120917383 missense probably benign
IGL02344:Ipo5 APN 14 120942779 splice site probably benign
IGL02657:Ipo5 APN 14 120943800 missense possibly damaging 0.47
IGL03094:Ipo5 APN 14 120943677 splice site probably benign
IGL03158:Ipo5 APN 14 120941891 splice site probably benign
IGL03309:Ipo5 APN 14 120920004 missense probably benign
IGL03392:Ipo5 APN 14 120942687 missense probably damaging 0.99
3-1:Ipo5 UTSW 14 120932936 missense probably benign 0.41
PIT4544001:Ipo5 UTSW 14 120928537 missense probably damaging 0.99
R0326:Ipo5 UTSW 14 120922223 missense probably benign 0.19
R0505:Ipo5 UTSW 14 120942733 missense possibly damaging 0.74
R0559:Ipo5 UTSW 14 120938641 missense probably damaging 1.00
R0969:Ipo5 UTSW 14 120944525 missense possibly damaging 0.64
R1450:Ipo5 UTSW 14 120944393 missense probably benign 0.04
R1672:Ipo5 UTSW 14 120933302 missense probably damaging 1.00
R2471:Ipo5 UTSW 14 120922162 missense probably benign 0.12
R3508:Ipo5 UTSW 14 120939544 missense probably damaging 1.00
R3696:Ipo5 UTSW 14 120922162 missense probably benign 0.12
R4118:Ipo5 UTSW 14 120938661 missense probably benign 0.04
R4418:Ipo5 UTSW 14 120943893 missense possibly damaging 0.81
R4760:Ipo5 UTSW 14 120941642 missense probably benign 0.02
R4839:Ipo5 UTSW 14 120920038 missense probably benign 0.00
R4913:Ipo5 UTSW 14 120935086 missense probably damaging 1.00
R5326:Ipo5 UTSW 14 120926271 missense probably benign
R5339:Ipo5 UTSW 14 120943710 missense probably damaging 1.00
R5483:Ipo5 UTSW 14 120920038 missense probably benign 0.06
R5542:Ipo5 UTSW 14 120926271 missense probably benign
R5579:Ipo5 UTSW 14 120938613 missense probably benign 0.26
R5954:Ipo5 UTSW 14 120919984 missense probably damaging 1.00
R6948:Ipo5 UTSW 14 120923115 missense probably benign 0.00
R7365:Ipo5 UTSW 14 120920085 missense probably benign
R7563:Ipo5 UTSW 14 120946155 missense probably benign 0.00
R7782:Ipo5 UTSW 14 120933125 missense possibly damaging 0.95
W0251:Ipo5 UTSW 14 120938785 missense probably benign 0.17
X0062:Ipo5 UTSW 14 120941671 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CGAGAACCGTTCTGGTCCCATTTC -3'
(R):5'- TCAGGTCGCACAGGTAACTGAAGG -3'

Sequencing Primer
(F):5'- GGCTATCAAGCACATACAGTG -3'
(R):5'- CACAGGTAACTGAAGGTCTGG -3'
Posted On2013-07-11