Mutagenetix > Incidental Mutation

Incidental Mutation 'R0590:Ipo5'

55940

Institutional Source

Beutler Lab

Gene Symbol

Ipo5

Ensembl Gene

ENSMUSG00000030662

Gene Name

importin 5

Synonyms

Ranbp5, Kpnb3, 5730478E03Rik, IMB3, 1110011C18Rik

MMRRC Submission

038780-MU

Accession Numbers

Genbank: NM_023579; MGI: 1917822

Essential gene?

Probably essential (E-score: 0.942) question?

Stock #

R0590 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

120911224-120947999 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 120944357 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 954 (V954A)

Ref Sequence

ENSEMBL: ENSMUSP00000032898 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032898]

AlphaFold

Q8BKC5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000032898
AA Change: V954A

PolyPhen 2 Score 0.757 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000032898
Gene: ENSMUSG00000030662
AA Change: V954A

Domain	Start	End	E-Value	Type
low complexity region	65	72	N/A	INTRINSIC
Pfam:HEAT_2	359	467	3.3e-13	PFAM
Pfam:HEAT_EZ	372	426	3.7e-10	PFAM
Pfam:Vac14_Fab1_bd	373	430	3.8e-9	PFAM
Pfam:HEAT	400	430	4.2e-7	PFAM
Pfam:HEAT	906	936	4.2e-6	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228277

Meta Mutation Damage Score

0.4644

Coding Region Coverage

1x: 99.4%
3x: 99.0%
10x: 97.7%
20x: 95.7%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleocytoplasmic transport, a signal- and energy-dependent process, takes place through nuclear pore complexes embedded in the nuclear envelope. The import of proteins containing a nuclear localization signal (NLS) requires the NLS import receptor, a heterodimer of importin alpha and beta subunits also known as karyopherins. Importin alpha binds the NLS-containing cargo in the cytoplasm and importin beta docks the complex at the cytoplasmic side of the nuclear pore complex. In the presence of nucleoside triphosphates and the small GTP binding protein Ran, the complex moves into the nuclear pore complex and the importin subunits dissociate. Importin alpha enters the nucleoplasm with its passenger protein and importin beta remains at the pore. Interactions between importin beta and the FG repeats of nucleoporins are essential in translocation through the pore complex. The protein encoded by this gene is a member of the importin beta family. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(33) : Targeted, other(2) Gene trapped(31)

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acnat2	C	T	4: 49,383,273	M93I	probably benign	Het
Adamts16	T	C	13: 70,800,954	D196G	probably benign	Het
Adhfe1	T	A	1: 9,548,153		probably null	Het
AI661453	A	G	17: 47,467,074		probably benign	Het
Apc	G	T	18: 34,316,230	E2026*	probably null	Het
Atg2a	GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC	GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC	19: 6,245,007		probably benign	Het
BC017158	A	G	7: 128,297,470	L134P	probably damaging	Het
Cad	T	C	5: 31,062,231	S688P	probably damaging	Het
Ccdc191	C	T	16: 43,931,341	R345*	probably null	Het
Dcaf13	T	A	15: 39,145,085		probably benign	Het
Drc1	A	G	5: 30,363,136	D607G	probably benign	Het
Fam160a1	T	C	3: 85,672,376	R841G	probably benign	Het
Gli1	G	T	10: 127,331,563	A607E	possibly damaging	Het
Gls	G	A	1: 52,212,375		probably benign	Het
Gria1	A	T	11: 57,289,409	Q728H	probably damaging	Het
Hcrtr1	A	G	4: 130,135,694	L198P	probably damaging	Het
Ifngr1	T	A	10: 19,603,942		probably benign	Het
Kcnh5	G	T	12: 74,965,261	A628D	probably damaging	Het
Kif14	T	C	1: 136,482,472	S646P	probably damaging	Het
Ksr1	A	G	11: 79,045,140	S133P	probably damaging	Het
Neb	T	C	2: 52,137,290	M7143V	probably damaging	Het
Nelfa	G	A	5: 33,901,825	P229S	probably damaging	Het
Nfatc2	T	C	2: 168,571,199	T169A	probably damaging	Het
Nr1h4	A	G	10: 89,456,567	Y398H	probably damaging	Het
Nrcam	A	G	12: 44,564,032	E511G	probably damaging	Het
Ocstamp	T	A	2: 165,397,751	R172W	probably damaging	Het
Olfr1130	A	G	2: 87,607,994	E202G	probably damaging	Het
Olfr26	T	A	9: 38,855,470	M136K	probably damaging	Het
Olfr27	T	C	9: 39,144,721	V207A	probably benign	Het
Phf14	G	A	6: 11,961,578	V405I	possibly damaging	Het
Plk5	G	A	10: 80,360,223	R238H	probably damaging	Het
Pole	A	G	5: 110,317,926	E1240G	probably benign	Het
Prdm15	A	G	16: 97,797,761	I899T	possibly damaging	Het
Psip1	T	C	4: 83,458,144	N486S	probably benign	Het
Rlf	A	G	4: 121,170,833		probably benign	Het
Rttn	T	C	18: 88,979,635	S255P	probably damaging	Het
Sema6c	A	G	3: 95,172,623	K711E	probably damaging	Het
Slc4a10	A	T	2: 62,190,893		probably benign	Het
Trim36	T	G	18: 46,172,576	S435R	probably benign	Het
Ucp1	A	G	8: 83,291,603		probably benign	Het
Vmn1r17	T	C	6: 57,361,014	Y122C	probably benign	Het
Vmn1r23	A	G	6: 57,926,364	V143A	probably benign	Het
Wdfy4	T	A	14: 33,041,174	Q2166L	probably benign	Het
Zc3h7b	C	T	15: 81,776,998	T346M	possibly damaging	Het
Zfhx4	T	A	3: 5,402,633	V2617D	probably damaging	Het

Other mutations in Ipo5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01461:Ipo5	APN	14	120928533	missense	probably damaging	0.98
IGL01614:Ipo5	APN	14	120935095	missense	probably benign	0.01
IGL01835:Ipo5	APN	14	120926238	missense	probably benign	0.24
IGL02010:Ipo5	APN	14	120933377	missense	probably benign	0.20
IGL02303:Ipo5	APN	14	120917383	missense	probably benign
IGL02344:Ipo5	APN	14	120942779	splice site	probably benign
IGL02657:Ipo5	APN	14	120943800	missense	possibly damaging	0.47
IGL03094:Ipo5	APN	14	120943677	splice site	probably benign
IGL03158:Ipo5	APN	14	120941891	splice site	probably benign
IGL03309:Ipo5	APN	14	120920004	missense	probably benign
IGL03392:Ipo5	APN	14	120942687	missense	probably damaging	0.99
3-1:Ipo5	UTSW	14	120932936	missense	probably benign	0.41
PIT4544001:Ipo5	UTSW	14	120928537	missense	probably damaging	0.99
R0326:Ipo5	UTSW	14	120922223	missense	probably benign	0.19
R0505:Ipo5	UTSW	14	120942733	missense	possibly damaging	0.74
R0559:Ipo5	UTSW	14	120938641	missense	probably damaging	1.00
R0969:Ipo5	UTSW	14	120944525	missense	possibly damaging	0.64
R1450:Ipo5	UTSW	14	120944393	missense	probably benign	0.04
R1672:Ipo5	UTSW	14	120933302	missense	probably damaging	1.00
R2471:Ipo5	UTSW	14	120922162	missense	probably benign	0.12
R3508:Ipo5	UTSW	14	120939544	missense	probably damaging	1.00
R3696:Ipo5	UTSW	14	120922162	missense	probably benign	0.12
R4118:Ipo5	UTSW	14	120938661	missense	probably benign	0.04
R4418:Ipo5	UTSW	14	120943893	missense	possibly damaging	0.81
R4760:Ipo5	UTSW	14	120941642	missense	probably benign	0.02
R4839:Ipo5	UTSW	14	120920038	missense	probably benign	0.00
R4913:Ipo5	UTSW	14	120935086	missense	probably damaging	1.00
R5326:Ipo5	UTSW	14	120926271	missense	probably benign
R5339:Ipo5	UTSW	14	120943710	missense	probably damaging	1.00
R5483:Ipo5	UTSW	14	120920038	missense	probably benign	0.06
R5542:Ipo5	UTSW	14	120926271	missense	probably benign
R5579:Ipo5	UTSW	14	120938613	missense	probably benign	0.26
R5954:Ipo5	UTSW	14	120919984	missense	probably damaging	1.00
R6948:Ipo5	UTSW	14	120923115	missense	probably benign	0.00
R7365:Ipo5	UTSW	14	120920085	missense	probably benign
R7563:Ipo5	UTSW	14	120946155	missense	probably benign	0.00
R7782:Ipo5	UTSW	14	120933125	missense	possibly damaging	0.95
R7911:Ipo5	UTSW	14	120929639	splice site	probably null
R8222:Ipo5	UTSW	14	120920002	missense	probably benign	0.00
R8238:Ipo5	UTSW	14	120935240	missense	probably damaging	1.00
R8483:Ipo5	UTSW	14	120946148	missense	probably benign
R8826:Ipo5	UTSW	14	120919954	missense	probably damaging	1.00
R9042:Ipo5	UTSW	14	120923135	missense	probably benign	0.01
W0251:Ipo5	UTSW	14	120938785	missense	probably benign	0.17
X0062:Ipo5	UTSW	14	120941671	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- CGAGAACCGTTCTGGTCCCATTTC -3'
(R):5'- TCAGGTCGCACAGGTAACTGAAGG -3'

Sequencing Primer
(F):5'- GGCTATCAAGCACATACAGTG -3'
(R):5'- CACAGGTAACTGAAGGTCTGG -3'

Posted On

2013-07-11