Incidental Mutation 'R0590:Zc3h7b'
ID 55942
Institutional Source Beutler Lab
Gene Symbol Zc3h7b
Ensembl Gene ENSMUSG00000022390
Gene Name zinc finger CCCH type containing 7B
Synonyms Scrg3
MMRRC Submission 038780-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.229) question?
Stock # R0590 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 81629299-81680470 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 81661199 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 346 (T346M)
Ref Sequence ENSEMBL: ENSMUSP00000105181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109554] [ENSMUST00000230946]
AlphaFold F8VPP8
Predicted Effect possibly damaging
Transcript: ENSMUST00000109554
AA Change: T346M

PolyPhen 2 Score 0.739 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105181
Gene: ENSMUSG00000022390
AA Change: T346M

DomainStartEndE-ValueType
Pfam:TPR_11 34 113 2.3e-12 PFAM
Pfam:TPR_1 82 115 2.4e-6 PFAM
Pfam:TPR_8 82 115 8.2e-4 PFAM
Pfam:TPR_8 116 143 4.8e-3 PFAM
low complexity region 294 309 N/A INTRINSIC
low complexity region 340 354 N/A INTRINSIC
ZnF_C3H1 482 508 2.15e1 SMART
ZnF_C3H1 612 638 2.03e1 SMART
ZnF_C3H1 757 782 8.31e0 SMART
ZnF_C2H2 843 867 2.86e-1 SMART
ZnF_C3H1 889 914 7.81e-1 SMART
low complexity region 959 981 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229044
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230368
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230590
Predicted Effect probably benign
Transcript: ENSMUST00000230946
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231108
Meta Mutation Damage Score 0.1066 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a tetratricopeptide repeat domain. The encoded protein also interacts with the rotavirus non-structural protein NSP3. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(9) : Gene trapped(9)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acnat2 C T 4: 49,383,273 (GRCm39) M93I probably benign Het
Adamts16 T C 13: 70,949,073 (GRCm39) D196G probably benign Het
Adhfe1 T A 1: 9,618,378 (GRCm39) probably null Het
AI661453 A G 17: 47,777,999 (GRCm39) probably benign Het
Apc G T 18: 34,449,283 (GRCm39) E2026* probably null Het
Atg2a GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC 19: 6,295,037 (GRCm39) probably benign Het
Cad T C 5: 31,219,575 (GRCm39) S688P probably damaging Het
Ccdc191 C T 16: 43,751,704 (GRCm39) R345* probably null Het
Dcaf13 T A 15: 39,008,480 (GRCm39) probably benign Het
Drc1 A G 5: 30,520,480 (GRCm39) D607G probably benign Het
Fhip1a T C 3: 85,579,683 (GRCm39) R841G probably benign Het
Gli1 G T 10: 127,167,432 (GRCm39) A607E possibly damaging Het
Gls G A 1: 52,251,534 (GRCm39) probably benign Het
Gria1 A T 11: 57,180,235 (GRCm39) Q728H probably damaging Het
Hcrtr1 A G 4: 130,029,487 (GRCm39) L198P probably damaging Het
Ifngr1 T A 10: 19,479,690 (GRCm39) probably benign Het
Ipo5 T C 14: 121,181,769 (GRCm39) V954A possibly damaging Het
Kcnh5 G T 12: 75,012,035 (GRCm39) A628D probably damaging Het
Kif14 T C 1: 136,410,210 (GRCm39) S646P probably damaging Het
Ksr1 A G 11: 78,935,966 (GRCm39) S133P probably damaging Het
Neb T C 2: 52,027,302 (GRCm39) M7143V probably damaging Het
Nelfa G A 5: 34,059,169 (GRCm39) P229S probably damaging Het
Nfatc2 T C 2: 168,413,119 (GRCm39) T169A probably damaging Het
Nr1h4 A G 10: 89,292,429 (GRCm39) Y398H probably damaging Het
Nrcam A G 12: 44,610,815 (GRCm39) E511G probably damaging Het
Ocstamp T A 2: 165,239,671 (GRCm39) R172W probably damaging Het
Or10ag60 A G 2: 87,438,338 (GRCm39) E202G probably damaging Het
Or8d1 T A 9: 38,766,766 (GRCm39) M136K probably damaging Het
Or8g19 T C 9: 39,056,017 (GRCm39) V207A probably benign Het
Phf14 G A 6: 11,961,577 (GRCm39) V405I possibly damaging Het
Plk5 G A 10: 80,196,057 (GRCm39) R238H probably damaging Het
Pole A G 5: 110,465,792 (GRCm39) E1240G probably benign Het
Prdm15 A G 16: 97,598,961 (GRCm39) I899T possibly damaging Het
Psip1 T C 4: 83,376,381 (GRCm39) N486S probably benign Het
Rlf A G 4: 121,028,030 (GRCm39) probably benign Het
Rttn T C 18: 88,997,759 (GRCm39) S255P probably damaging Het
Rusf1 A G 7: 127,896,642 (GRCm39) L134P probably damaging Het
Sema6c A G 3: 95,079,934 (GRCm39) K711E probably damaging Het
Slc4a10 A T 2: 62,021,237 (GRCm39) probably benign Het
Trim36 T G 18: 46,305,643 (GRCm39) S435R probably benign Het
Ucp1 A G 8: 84,018,232 (GRCm39) probably benign Het
Vmn1r17 T C 6: 57,337,999 (GRCm39) Y122C probably benign Het
Vmn1r23 A G 6: 57,903,349 (GRCm39) V143A probably benign Het
Wdfy4 T A 14: 32,763,131 (GRCm39) Q2166L probably benign Het
Zfhx4 T A 3: 5,467,693 (GRCm39) V2617D probably damaging Het
Other mutations in Zc3h7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01726:Zc3h7b APN 15 81,656,000 (GRCm39) missense possibly damaging 0.95
IGL01955:Zc3h7b APN 15 81,676,205 (GRCm39) missense probably benign 0.10
IGL02526:Zc3h7b APN 15 81,677,338 (GRCm39) missense probably benign 0.10
IGL02582:Zc3h7b APN 15 81,653,341 (GRCm39) missense probably benign 0.05
IGL02736:Zc3h7b APN 15 81,676,175 (GRCm39) missense probably benign 0.02
F6893:Zc3h7b UTSW 15 81,662,872 (GRCm39) missense possibly damaging 0.94
R0212:Zc3h7b UTSW 15 81,660,529 (GRCm39) missense probably benign 0.00
R0242:Zc3h7b UTSW 15 81,653,031 (GRCm39) splice site probably benign
R0471:Zc3h7b UTSW 15 81,666,169 (GRCm39) missense probably damaging 1.00
R1530:Zc3h7b UTSW 15 81,661,289 (GRCm39) missense probably benign
R1563:Zc3h7b UTSW 15 81,661,289 (GRCm39) missense probably benign
R1565:Zc3h7b UTSW 15 81,661,289 (GRCm39) missense probably benign
R1566:Zc3h7b UTSW 15 81,653,035 (GRCm39) missense possibly damaging 0.91
R1670:Zc3h7b UTSW 15 81,661,268 (GRCm39) missense probably benign
R1712:Zc3h7b UTSW 15 81,661,289 (GRCm39) missense probably benign
R1727:Zc3h7b UTSW 15 81,652,230 (GRCm39) missense probably damaging 1.00
R2069:Zc3h7b UTSW 15 81,676,529 (GRCm39) missense probably damaging 0.98
R2375:Zc3h7b UTSW 15 81,676,703 (GRCm39) missense probably benign 0.17
R2656:Zc3h7b UTSW 15 81,664,631 (GRCm39) missense probably damaging 1.00
R4660:Zc3h7b UTSW 15 81,676,451 (GRCm39) missense probably benign 0.07
R4764:Zc3h7b UTSW 15 81,653,384 (GRCm39) critical splice donor site probably null
R4815:Zc3h7b UTSW 15 81,677,864 (GRCm39) missense probably damaging 1.00
R4999:Zc3h7b UTSW 15 81,663,334 (GRCm39) missense probably damaging 1.00
R5086:Zc3h7b UTSW 15 81,677,375 (GRCm39) missense probably damaging 0.96
R5169:Zc3h7b UTSW 15 81,657,515 (GRCm39) missense probably benign 0.01
R5395:Zc3h7b UTSW 15 81,656,702 (GRCm39) missense possibly damaging 0.50
R5407:Zc3h7b UTSW 15 81,670,092 (GRCm39) missense probably damaging 0.99
R5587:Zc3h7b UTSW 15 81,656,059 (GRCm39) missense possibly damaging 0.80
R5721:Zc3h7b UTSW 15 81,657,499 (GRCm39) missense probably benign 0.02
R6001:Zc3h7b UTSW 15 81,676,236 (GRCm39) missense possibly damaging 0.89
R6151:Zc3h7b UTSW 15 81,662,911 (GRCm39) critical splice donor site probably null
R6248:Zc3h7b UTSW 15 81,667,386 (GRCm39) missense probably damaging 1.00
R6397:Zc3h7b UTSW 15 81,677,055 (GRCm39) missense probably benign 0.03
R6502:Zc3h7b UTSW 15 81,653,252 (GRCm39) missense probably benign 0.01
R7248:Zc3h7b UTSW 15 81,655,988 (GRCm39) missense possibly damaging 0.46
R7397:Zc3h7b UTSW 15 81,653,354 (GRCm39) missense possibly damaging 0.50
R7450:Zc3h7b UTSW 15 81,667,281 (GRCm39) missense probably benign
R7471:Zc3h7b UTSW 15 81,664,682 (GRCm39) missense probably damaging 1.00
R7575:Zc3h7b UTSW 15 81,662,086 (GRCm39) nonsense probably null
R7645:Zc3h7b UTSW 15 81,664,803 (GRCm39) missense probably damaging 1.00
R7650:Zc3h7b UTSW 15 81,677,851 (GRCm39) missense possibly damaging 0.81
R7881:Zc3h7b UTSW 15 81,664,679 (GRCm39) missense probably damaging 1.00
R7918:Zc3h7b UTSW 15 81,653,189 (GRCm39) missense probably damaging 0.98
R8001:Zc3h7b UTSW 15 81,663,461 (GRCm39) nonsense probably null
R8504:Zc3h7b UTSW 15 81,664,719 (GRCm39) missense probably damaging 1.00
R8855:Zc3h7b UTSW 15 81,656,681 (GRCm39) missense probably benign 0.01
R8856:Zc3h7b UTSW 15 81,656,681 (GRCm39) missense probably benign 0.01
R8857:Zc3h7b UTSW 15 81,656,681 (GRCm39) missense probably benign 0.01
R8865:Zc3h7b UTSW 15 81,656,681 (GRCm39) missense probably benign 0.01
R8866:Zc3h7b UTSW 15 81,656,681 (GRCm39) missense probably benign 0.01
R8867:Zc3h7b UTSW 15 81,656,681 (GRCm39) missense probably benign 0.01
R8868:Zc3h7b UTSW 15 81,656,681 (GRCm39) missense probably benign 0.01
R9071:Zc3h7b UTSW 15 81,677,964 (GRCm39) makesense probably null
R9136:Zc3h7b UTSW 15 81,653,312 (GRCm39) missense probably damaging 1.00
R9169:Zc3h7b UTSW 15 81,661,184 (GRCm39) missense probably benign 0.19
R9701:Zc3h7b UTSW 15 81,676,505 (GRCm39) missense probably damaging 1.00
R9802:Zc3h7b UTSW 15 81,676,505 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGTCATACCCACACGGGGTTG -3'
(R):5'- CTGTGGAGATGCAGAGCTTCAGAG -3'

Sequencing Primer
(F):5'- GTATGCCTAGTGAGCTGCCTC -3'
(R):5'- TGCAGAGCTTCAGAGATGAG -3'
Posted On 2013-07-11