Mutagenetix > Incidental Mutation

Incidental Mutation 'R0590:Zc3h7b'

55942

Institutional Source

Beutler Lab

Gene Symbol

Zc3h7b

Ensembl Gene

ENSMUSG00000022390

Gene Name

zinc finger CCCH type containing 7B

Synonyms

Scrg3

MMRRC Submission

038780-MU

Accession Numbers

Genbank: NM_001081016; MGI: 1328310

Is this an essential gene?

Probably non essential (E-score: 0.219) question?

Stock #

R0590 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

81745057-81796260 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 81776998 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 346 (T346M)

Ref Sequence

ENSEMBL: ENSMUSP00000105181 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109554] [ENSMUST00000230946]

AlphaFold

F8VPP8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109554
AA Change: T346M

PolyPhen 2 Score 0.739 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000105181
Gene: ENSMUSG00000022390
AA Change: T346M

Domain	Start	End	E-Value	Type
Pfam:TPR_11	34	113	2.3e-12	PFAM
Pfam:TPR_1	82	115	2.4e-6	PFAM
Pfam:TPR_8	82	115	8.2e-4	PFAM
Pfam:TPR_8	116	143	4.8e-3	PFAM
low complexity region	294	309	N/A	INTRINSIC
low complexity region	340	354	N/A	INTRINSIC
ZnF_C3H1	482	508	2.15e1	SMART
ZnF_C3H1	612	638	2.03e1	SMART
ZnF_C3H1	757	782	8.31e0	SMART
ZnF_C2H2	843	867	2.86e-1	SMART
ZnF_C3H1	889	914	7.81e-1	SMART
low complexity region	959	981	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229044

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230368

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230590

Predicted Effect

probably benign
Transcript: ENSMUST00000230946

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231108

Meta Mutation Damage Score

0.1066

Coding Region Coverage

1x: 99.4%
3x: 99.0%
10x: 97.7%
20x: 95.7%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a tetratricopeptide repeat domain. The encoded protein also interacts with the rotavirus non-structural protein NSP3. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(9) : Gene trapped(9)

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acnat2	C	T	4: 49,383,273	M93I	probably benign	Het
Adamts16	T	C	13: 70,800,954	D196G	probably benign	Het
Adhfe1	T	A	1: 9,548,153		probably null	Het
AI661453	A	G	17: 47,467,074		probably benign	Het
Apc	G	T	18: 34,316,230	E2026*	probably null	Het
Atg2a	GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC	GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC	19: 6,245,007		probably benign	Het
BC017158	A	G	7: 128,297,470	L134P	probably damaging	Het
Cad	T	C	5: 31,062,231	S688P	probably damaging	Het
Ccdc191	C	T	16: 43,931,341	R345*	probably null	Het
Dcaf13	T	A	15: 39,145,085		probably benign	Het
Drc1	A	G	5: 30,363,136	D607G	probably benign	Het
Fam160a1	T	C	3: 85,672,376	R841G	probably benign	Het
Gli1	G	T	10: 127,331,563	A607E	possibly damaging	Het
Gls	G	A	1: 52,212,375		probably benign	Het
Gria1	A	T	11: 57,289,409	Q728H	probably damaging	Het
Hcrtr1	A	G	4: 130,135,694	L198P	probably damaging	Het
Ifngr1	T	A	10: 19,603,942		probably benign	Het
Ipo5	T	C	14: 120,944,357	V954A	possibly damaging	Het
Kcnh5	G	T	12: 74,965,261	A628D	probably damaging	Het
Kif14	T	C	1: 136,482,472	S646P	probably damaging	Het
Ksr1	A	G	11: 79,045,140	S133P	probably damaging	Het
Neb	T	C	2: 52,137,290	M7143V	probably damaging	Het
Nelfa	G	A	5: 33,901,825	P229S	probably damaging	Het
Nfatc2	T	C	2: 168,571,199	T169A	probably damaging	Het
Nr1h4	A	G	10: 89,456,567	Y398H	probably damaging	Het
Nrcam	A	G	12: 44,564,032	E511G	probably damaging	Het
Ocstamp	T	A	2: 165,397,751	R172W	probably damaging	Het
Olfr1130	A	G	2: 87,607,994	E202G	probably damaging	Het
Olfr26	T	A	9: 38,855,470	M136K	probably damaging	Het
Olfr27	T	C	9: 39,144,721	V207A	probably benign	Het
Phf14	G	A	6: 11,961,578	V405I	possibly damaging	Het
Plk5	G	A	10: 80,360,223	R238H	probably damaging	Het
Pole	A	G	5: 110,317,926	E1240G	probably benign	Het
Prdm15	A	G	16: 97,797,761	I899T	possibly damaging	Het
Psip1	T	C	4: 83,458,144	N486S	probably benign	Het
Rlf	A	G	4: 121,170,833		probably benign	Het
Rttn	T	C	18: 88,979,635	S255P	probably damaging	Het
Sema6c	A	G	3: 95,172,623	K711E	probably damaging	Het
Slc4a10	A	T	2: 62,190,893		probably benign	Het
Trim36	T	G	18: 46,172,576	S435R	probably benign	Het
Ucp1	A	G	8: 83,291,603		probably benign	Het
Vmn1r17	T	C	6: 57,361,014	Y122C	probably benign	Het
Vmn1r23	A	G	6: 57,926,364	V143A	probably benign	Het
Wdfy4	T	A	14: 33,041,174	Q2166L	probably benign	Het
Zfhx4	T	A	3: 5,402,633	V2617D	probably damaging	Het

Other mutations in Zc3h7b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01726:Zc3h7b	APN	15	81771799	missense	possibly damaging	0.95
IGL01955:Zc3h7b	APN	15	81792004	missense	probably benign	0.10
IGL02526:Zc3h7b	APN	15	81793137	missense	probably benign	0.10
IGL02582:Zc3h7b	APN	15	81769140	missense	probably benign	0.05
IGL02736:Zc3h7b	APN	15	81791974	missense	probably benign	0.02
F6893:Zc3h7b	UTSW	15	81778671	missense	possibly damaging	0.94
R0212:Zc3h7b	UTSW	15	81776328	missense	probably benign	0.00
R0242:Zc3h7b	UTSW	15	81768830	splice site	probably benign
R0471:Zc3h7b	UTSW	15	81781968	missense	probably damaging	1.00
R1530:Zc3h7b	UTSW	15	81777088	missense	probably benign
R1563:Zc3h7b	UTSW	15	81777088	missense	probably benign
R1565:Zc3h7b	UTSW	15	81777088	missense	probably benign
R1566:Zc3h7b	UTSW	15	81768834	missense	possibly damaging	0.91
R1670:Zc3h7b	UTSW	15	81777067	missense	probably benign
R1712:Zc3h7b	UTSW	15	81777088	missense	probably benign
R1727:Zc3h7b	UTSW	15	81768029	missense	probably damaging	1.00
R2069:Zc3h7b	UTSW	15	81792328	missense	probably damaging	0.98
R2375:Zc3h7b	UTSW	15	81792502	missense	probably benign	0.17
R2656:Zc3h7b	UTSW	15	81780430	missense	probably damaging	1.00
R4660:Zc3h7b	UTSW	15	81792250	missense	probably benign	0.07
R4764:Zc3h7b	UTSW	15	81769183	critical splice donor site	probably null
R4815:Zc3h7b	UTSW	15	81793663	missense	probably damaging	1.00
R4999:Zc3h7b	UTSW	15	81779133	missense	probably damaging	1.00
R5086:Zc3h7b	UTSW	15	81793174	missense	probably damaging	0.96
R5169:Zc3h7b	UTSW	15	81773314	missense	probably benign	0.01
R5395:Zc3h7b	UTSW	15	81772501	missense	possibly damaging	0.50
R5407:Zc3h7b	UTSW	15	81785891	missense	probably damaging	0.99
R5587:Zc3h7b	UTSW	15	81771858	missense	possibly damaging	0.80
R5721:Zc3h7b	UTSW	15	81773298	missense	probably benign	0.02
R6001:Zc3h7b	UTSW	15	81792035	missense	possibly damaging	0.89
R6151:Zc3h7b	UTSW	15	81778710	critical splice donor site	probably null
R6248:Zc3h7b	UTSW	15	81783185	missense	probably damaging	1.00
R6397:Zc3h7b	UTSW	15	81792854	missense	probably benign	0.03
R6502:Zc3h7b	UTSW	15	81769051	missense	probably benign	0.01
R7248:Zc3h7b	UTSW	15	81771787	missense	possibly damaging	0.46
R7397:Zc3h7b	UTSW	15	81769153	missense	possibly damaging	0.50
R7450:Zc3h7b	UTSW	15	81783080	missense	probably benign
R7471:Zc3h7b	UTSW	15	81780481	missense	probably damaging	1.00
R7575:Zc3h7b	UTSW	15	81777885	nonsense	probably null
R7645:Zc3h7b	UTSW	15	81780602	missense	probably damaging	1.00
R7650:Zc3h7b	UTSW	15	81793650	missense	possibly damaging	0.81
R7881:Zc3h7b	UTSW	15	81780478	missense	probably damaging	1.00
R7918:Zc3h7b	UTSW	15	81768988	missense	probably damaging	0.98
R8001:Zc3h7b	UTSW	15	81779260	nonsense	probably null
R8504:Zc3h7b	UTSW	15	81780518	missense	probably damaging	1.00
R8855:Zc3h7b	UTSW	15	81772480	missense	probably benign	0.01
R8856:Zc3h7b	UTSW	15	81772480	missense	probably benign	0.01
R8857:Zc3h7b	UTSW	15	81772480	missense	probably benign	0.01
R8865:Zc3h7b	UTSW	15	81772480	missense	probably benign	0.01
R8866:Zc3h7b	UTSW	15	81772480	missense	probably benign	0.01
R8867:Zc3h7b	UTSW	15	81772480	missense	probably benign	0.01
R8868:Zc3h7b	UTSW	15	81772480	missense	probably benign	0.01
R9071:Zc3h7b	UTSW	15	81793763	makesense	probably null
R9136:Zc3h7b	UTSW	15	81769111	missense	probably damaging	1.00
R9169:Zc3h7b	UTSW	15	81776983	missense	probably benign	0.19
R9701:Zc3h7b	UTSW	15	81792304	missense	probably damaging	1.00
R9802:Zc3h7b	UTSW	15	81792304	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATGTCATACCCACACGGGGTTG -3'
(R):5'- CTGTGGAGATGCAGAGCTTCAGAG -3'

Sequencing Primer
(F):5'- GTATGCCTAGTGAGCTGCCTC -3'
(R):5'- TGCAGAGCTTCAGAGATGAG -3'

Posted On

2013-07-11