Incidental Mutation 'R7188:Ppp1r3a'
ID 559421
Institutional Source Beutler Lab
Gene Symbol Ppp1r3a
Ensembl Gene ENSMUSG00000042717
Gene Name protein phosphatase 1, regulatory subunit 3A
Synonyms RGL, GM
MMRRC Submission 045272-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7188 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 14713976-14755273 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 14719190 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 575 (S575G)
Ref Sequence ENSEMBL: ENSMUSP00000049054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045096]
AlphaFold Q99MR9
Predicted Effect probably benign
Transcript: ENSMUST00000045096
AA Change: S575G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000049054
Gene: ENSMUSG00000042717
AA Change: S575G

DomainStartEndE-ValueType
low complexity region 37 51 N/A INTRINSIC
Pfam:CBM_21 124 231 2.3e-32 PFAM
low complexity region 370 381 N/A INTRINSIC
low complexity region 636 646 N/A INTRINSIC
low complexity region 952 961 N/A INTRINSIC
transmembrane domain 1055 1077 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The glycogen-associated form of protein phosphatase-1 (PP1) derived from skeletal muscle is a heterodimer composed of a 37-kD catalytic subunit and a 124-kD targeting and regulatory subunit. This gene encodes the regulatory subunit which binds to muscle glycogen with high affinity, thereby enhancing dephosphorylation of glycogen-bound substrates for PP1 such as glycogen synthase and glycogen phosphorylase kinase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice have reduced levels of skeletal muscle glycogen. Whereas one model was normoglycemic and grossly normal, another on a similar genetic background was glucose intolerant, insulin resistant, and gained weight to the point of obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,554,600 (GRCm39) Y118C possibly damaging Het
Abcb6 A G 1: 75,150,781 (GRCm39) probably null Het
Acox2 T A 14: 8,252,996 (GRCm38) I236L possibly damaging Het
Adamts12 A T 15: 11,336,411 (GRCm39) K1499* probably null Het
Ankrd24 G T 10: 81,472,224 (GRCm39) E20* probably null Het
Arsa A T 15: 89,359,830 (GRCm39) Y32* probably null Het
Atp9b A G 18: 80,961,041 (GRCm39) S57P Het
Atr G T 9: 95,744,844 (GRCm39) E54* probably null Het
Bace1 A G 9: 45,767,393 (GRCm39) D192G probably benign Het
Bltp1 A T 3: 37,004,162 (GRCm39) T1624S probably benign Het
Bltp3b T C 10: 89,615,744 (GRCm39) V129A probably damaging Het
Cacna1d T C 14: 29,811,790 (GRCm39) S1309G probably benign Het
Cd177 G T 7: 24,456,072 (GRCm39) T232K probably damaging Het
Chil4 T A 3: 106,111,475 (GRCm39) D213V probably damaging Het
Cmya5 A T 13: 93,182,546 (GRCm39) I3538N probably damaging Het
Cyp26a1 T A 19: 37,687,753 (GRCm39) M287K possibly damaging Het
Dcaf5 T C 12: 80,446,732 (GRCm39) D129G probably damaging Het
Dnah12 A C 14: 26,536,370 (GRCm39) K2095N probably benign Het
Dnpep G A 1: 75,292,701 (GRCm39) S106L probably damaging Het
Dock2 C T 11: 34,189,675 (GRCm39) E1499K possibly damaging Het
Dus4l A G 12: 31,696,714 (GRCm39) F88L probably damaging Het
Fcrl2 A C 3: 87,166,830 (GRCm39) D54E probably benign Het
Fign T A 2: 63,809,950 (GRCm39) H440L possibly damaging Het
Gabpa A G 16: 84,643,174 (GRCm39) D157G probably damaging Het
Gapdh T A 6: 125,142,403 (GRCm39) probably benign Het
Gbp8 G T 5: 105,164,081 (GRCm39) R406S probably benign Het
Gm21775 A G Y: 10,553,894 (GRCm39) R148G possibly damaging Het
Gm28363 G A 1: 117,626,579 (GRCm39) V6I unknown Het
Gmps A G 3: 63,918,982 (GRCm39) D522G probably damaging Het
Gpr75 T C 11: 30,842,687 (GRCm39) S531P probably damaging Het
Hars2 G T 18: 36,923,614 (GRCm39) E468D probably benign Het
Jph4 C A 14: 55,352,664 (GRCm39) R23L probably damaging Het
Kctd12 T A 14: 103,219,230 (GRCm39) Y216F probably benign Het
L3mbtl1 G A 2: 162,791,460 (GRCm39) probably null Het
Lama4 G A 10: 38,841,729 (GRCm39) probably benign Het
Lyst T A 13: 13,926,675 (GRCm39) S3494T possibly damaging Het
Mybpc2 A G 7: 44,155,617 (GRCm39) S879P probably benign Het
Ncaph C T 2: 126,964,034 (GRCm39) V304M probably benign Het
Noto A T 6: 85,405,047 (GRCm39) I229F possibly damaging Het
Or10n7-ps1 T C 9: 39,597,731 (GRCm39) M170V unknown Het
Or4c29 T C 2: 88,740,203 (GRCm39) D178G probably damaging Het
Or8k25 T A 2: 86,243,695 (GRCm39) K234* probably null Het
Pald1 A T 10: 61,182,845 (GRCm39) V368E probably damaging Het
Pde9a T A 17: 31,678,071 (GRCm39) M217K probably damaging Het
Pira1 A T 7: 3,741,828 (GRCm39) V184E probably damaging Het
Pitpnm2 G T 5: 124,259,366 (GRCm39) A1323E probably benign Het
Prok1 T C 3: 107,146,941 (GRCm39) I9V probably benign Het
Ptprc A T 1: 137,998,918 (GRCm39) V905D probably damaging Het
Rbm25 G T 12: 83,710,772 (GRCm39) G295V unknown Het
Rreb1 T C 13: 38,100,544 (GRCm39) M225T possibly damaging Het
Ryr3 T C 2: 112,858,989 (GRCm39) K55E probably damaging Het
Saxo4 T A 19: 10,459,702 (GRCm39) M2L probably benign Het
Scgb2b26 G T 7: 33,644,379 (GRCm39) T4K probably damaging Het
Setx C A 2: 29,038,184 (GRCm39) D1556E probably benign Het
Sft2d1 C T 17: 8,542,164 (GRCm39) T136I possibly damaging Het
Sirt5 C T 13: 43,525,380 (GRCm39) A63V possibly damaging Het
Skor2 A G 18: 76,947,504 (GRCm39) T409A possibly damaging Het
Slc12a6 T C 2: 112,164,760 (GRCm39) M153T probably benign Het
Slc34a1 A G 13: 24,006,348 (GRCm39) Y458C probably damaging Het
Slc36a2 A G 11: 55,053,483 (GRCm39) V385A possibly damaging Het
St6galnac5 A T 3: 152,552,131 (GRCm39) H145Q probably damaging Het
Tal1 T A 4: 114,925,610 (GRCm39) N226K probably damaging Het
Tgtp2 G C 11: 48,950,135 (GRCm39) R146G probably damaging Het
Usp6nl T C 2: 6,445,330 (GRCm39) S436P probably benign Het
Utp3 A G 5: 88,702,621 (GRCm39) E50G probably benign Het
Zfp12 A T 5: 143,225,749 (GRCm39) Q19L probably damaging Het
Other mutations in Ppp1r3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Ppp1r3a APN 6 14,755,083 (GRCm39) missense probably damaging 1.00
IGL00670:Ppp1r3a APN 6 14,719,059 (GRCm39) missense probably benign 0.22
IGL00703:Ppp1r3a APN 6 14,718,407 (GRCm39) missense probably benign 0.02
IGL00726:Ppp1r3a APN 6 14,717,851 (GRCm39) missense probably benign 0.42
IGL00742:Ppp1r3a APN 6 14,718,608 (GRCm39) missense probably benign 0.36
IGL01477:Ppp1r3a APN 6 14,718,345 (GRCm39) missense probably damaging 0.99
IGL01632:Ppp1r3a APN 6 14,754,810 (GRCm39) missense probably damaging 1.00
IGL02162:Ppp1r3a APN 6 14,717,714 (GRCm39) missense probably damaging 1.00
IGL02374:Ppp1r3a APN 6 14,718,599 (GRCm39) missense probably damaging 1.00
IGL02539:Ppp1r3a APN 6 14,718,458 (GRCm39) missense probably benign 0.01
IGL02563:Ppp1r3a APN 6 14,719,761 (GRCm39) missense probably benign 0.20
IGL02929:Ppp1r3a APN 6 14,719,810 (GRCm39) missense probably benign 0.00
IGL03110:Ppp1r3a APN 6 14,722,064 (GRCm39) splice site probably benign
IGL03290:Ppp1r3a APN 6 14,754,771 (GRCm39) missense probably damaging 1.00
IGL03326:Ppp1r3a APN 6 14,719,765 (GRCm39) missense probably damaging 0.96
P0041:Ppp1r3a UTSW 6 14,719,696 (GRCm39) missense probably benign 0.00
PIT4445001:Ppp1r3a UTSW 6 14,717,776 (GRCm39) missense probably damaging 1.00
R0015:Ppp1r3a UTSW 6 14,717,660 (GRCm39) missense possibly damaging 0.58
R0077:Ppp1r3a UTSW 6 14,754,516 (GRCm39) missense possibly damaging 0.64
R0368:Ppp1r3a UTSW 6 14,718,959 (GRCm39) missense probably benign 0.26
R0391:Ppp1r3a UTSW 6 14,719,696 (GRCm39) missense probably benign 0.43
R1793:Ppp1r3a UTSW 6 14,754,717 (GRCm39) missense probably damaging 1.00
R1797:Ppp1r3a UTSW 6 14,717,981 (GRCm39) missense probably benign 0.02
R1855:Ppp1r3a UTSW 6 14,754,993 (GRCm39) missense probably damaging 1.00
R1864:Ppp1r3a UTSW 6 14,718,404 (GRCm39) missense probably damaging 1.00
R1865:Ppp1r3a UTSW 6 14,718,404 (GRCm39) missense probably damaging 1.00
R2046:Ppp1r3a UTSW 6 14,722,103 (GRCm39) missense probably benign 0.12
R2122:Ppp1r3a UTSW 6 14,721,874 (GRCm39) missense possibly damaging 0.95
R2437:Ppp1r3a UTSW 6 14,718,322 (GRCm39) missense probably benign 0.03
R2518:Ppp1r3a UTSW 6 14,719,377 (GRCm39) missense possibly damaging 0.95
R2887:Ppp1r3a UTSW 6 14,718,248 (GRCm39) missense possibly damaging 0.89
R2888:Ppp1r3a UTSW 6 14,718,248 (GRCm39) missense possibly damaging 0.89
R2889:Ppp1r3a UTSW 6 14,718,248 (GRCm39) missense possibly damaging 0.89
R3419:Ppp1r3a UTSW 6 14,719,413 (GRCm39) missense probably benign 0.01
R3886:Ppp1r3a UTSW 6 14,719,911 (GRCm39) missense possibly damaging 0.87
R3937:Ppp1r3a UTSW 6 14,719,073 (GRCm39) missense probably damaging 0.99
R3938:Ppp1r3a UTSW 6 14,719,073 (GRCm39) missense probably damaging 0.99
R4246:Ppp1r3a UTSW 6 14,719,780 (GRCm39) missense probably damaging 1.00
R4561:Ppp1r3a UTSW 6 14,754,681 (GRCm39) missense probably damaging 1.00
R4701:Ppp1r3a UTSW 6 14,718,992 (GRCm39) missense probably benign 0.00
R4853:Ppp1r3a UTSW 6 14,719,046 (GRCm39) missense probably benign 0.03
R5076:Ppp1r3a UTSW 6 14,754,680 (GRCm39) missense probably damaging 1.00
R5085:Ppp1r3a UTSW 6 14,719,603 (GRCm39) missense probably damaging 1.00
R5501:Ppp1r3a UTSW 6 14,719,417 (GRCm39) missense probably benign 0.02
R5725:Ppp1r3a UTSW 6 14,719,348 (GRCm39) missense probably benign 0.04
R5729:Ppp1r3a UTSW 6 14,719,762 (GRCm39) missense probably benign 0.06
R5741:Ppp1r3a UTSW 6 14,719,882 (GRCm39) missense probably damaging 0.97
R5841:Ppp1r3a UTSW 6 14,718,983 (GRCm39) missense probably benign 0.26
R5914:Ppp1r3a UTSW 6 14,718,988 (GRCm39) missense probably benign 0.09
R6091:Ppp1r3a UTSW 6 14,719,339 (GRCm39) missense probably benign 0.02
R6154:Ppp1r3a UTSW 6 14,754,603 (GRCm39) missense possibly damaging 0.88
R6218:Ppp1r3a UTSW 6 14,718,430 (GRCm39) missense probably damaging 0.99
R6813:Ppp1r3a UTSW 6 14,719,570 (GRCm39) missense probably benign 0.13
R6826:Ppp1r3a UTSW 6 14,718,980 (GRCm39) nonsense probably null
R6869:Ppp1r3a UTSW 6 14,754,825 (GRCm39) missense probably benign 0.39
R7109:Ppp1r3a UTSW 6 14,719,235 (GRCm39) missense probably benign 0.00
R7262:Ppp1r3a UTSW 6 14,719,069 (GRCm39) missense probably benign 0.04
R7341:Ppp1r3a UTSW 6 14,718,749 (GRCm39) missense probably damaging 0.97
R7770:Ppp1r3a UTSW 6 14,754,977 (GRCm39) missense probably benign 0.06
R7856:Ppp1r3a UTSW 6 14,718,025 (GRCm39) missense probably benign 0.01
R8309:Ppp1r3a UTSW 6 14,719,700 (GRCm39) missense probably benign 0.02
R8422:Ppp1r3a UTSW 6 14,718,434 (GRCm39) nonsense probably null
R8868:Ppp1r3a UTSW 6 14,755,014 (GRCm39) missense probably damaging 1.00
R9039:Ppp1r3a UTSW 6 14,754,525 (GRCm39) missense probably damaging 1.00
R9149:Ppp1r3a UTSW 6 14,722,098 (GRCm39) missense probably benign 0.32
R9302:Ppp1r3a UTSW 6 14,721,891 (GRCm39) missense probably benign 0.00
R9399:Ppp1r3a UTSW 6 14,755,010 (GRCm39) missense probably damaging 0.99
R9565:Ppp1r3a UTSW 6 14,719,466 (GRCm39) missense probably benign 0.02
R9730:Ppp1r3a UTSW 6 14,721,923 (GRCm39) missense probably benign 0.25
R9767:Ppp1r3a UTSW 6 14,718,101 (GRCm39) missense probably benign 0.03
R9782:Ppp1r3a UTSW 6 14,718,766 (GRCm39) missense probably damaging 1.00
Z1177:Ppp1r3a UTSW 6 14,755,150 (GRCm39) missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- AGTCTCACTTGTTTCTGACTGG -3'
(R):5'- AGGTGTTAATGAAAACCCAAGC -3'

Sequencing Primer
(F):5'- TGGGTTTCCAGAACGTTCC -3'
(R):5'- GCAAGAATTTTCAATCAGTATTCCAG -3'
Posted On 2019-06-26