Incidental Mutation 'R7188:Noto'
ID559422
Institutional Source Beutler Lab
Gene Symbol Noto
Ensembl Gene ENSMUSG00000068302
Gene Namenotochord homeobox
Synonymstc, MmNot, Not, Flh
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.342) question?
Stock #R7188 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location85423886-85428877 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85428065 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 229 (I229F)
Ref Sequence ENSEMBL: ENSMUSP00000087006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045693] [ENSMUST00000089578]
Predicted Effect probably benign
Transcript: ENSMUST00000045693
SMART Domains Protein: ENSMUSP00000048537
Gene: ENSMUSG00000033706

DomainStartEndE-ValueType
SET 21 357 8.15e-14 SMART
low complexity region 392 412 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000089578
AA Change: I229F

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000087006
Gene: ENSMUSG00000068302
AA Change: I229F

DomainStartEndE-ValueType
HOX 149 211 4.04e-22 SMART
low complexity region 213 225 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutant mice display decreased tail length, a truncated or disrupted notochord, abnormal and missing vertebrae, occasional hindlimb paralysis and postnatal lethality, and abnormal somite and sclerotome development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 36,950,013 T1624S probably benign Het
Abca17 T C 17: 24,335,626 Y118C possibly damaging Het
Abcb6 A G 1: 75,174,137 probably null Het
Acox2 T A 14: 8,252,996 I236L possibly damaging Het
Adamts12 A T 15: 11,336,325 K1499* probably null Het
Ankrd24 G T 10: 81,636,390 E20* probably null Het
Arsa A T 15: 89,475,627 Y32* probably null Het
Atp9b A G 18: 80,917,826 S57P Het
Atr G T 9: 95,862,791 E54* probably null Het
Bace1 A G 9: 45,856,095 D192G probably benign Het
Cacna1d T C 14: 30,089,833 S1309G probably benign Het
Cd177 G T 7: 24,756,647 T232K probably damaging Het
Chil4 T A 3: 106,204,159 D213V probably damaging Het
Cmya5 A T 13: 93,046,038 I3538N probably damaging Het
Cyp26a1 T A 19: 37,699,305 M287K possibly damaging Het
Dcaf5 T C 12: 80,399,958 D129G probably damaging Het
Dnah12 A C 14: 26,814,413 K2095N probably benign Het
Dnpep G A 1: 75,316,057 S106L probably damaging Het
Dock2 C T 11: 34,239,675 E1499K possibly damaging Het
Dus4l A G 12: 31,646,715 F88L probably damaging Het
Fcrls A C 3: 87,259,523 D54E probably benign Het
Fign T A 2: 63,979,606 H440L possibly damaging Het
Gabpa A G 16: 84,846,286 D157G probably damaging Het
Gapdh T A 6: 125,165,440 probably benign Het
Gbp8 G T 5: 105,016,215 R406S probably benign Het
Gm15922 A T 7: 3,738,829 V184E probably damaging Het
Gm21775 A G Y: 10,553,894 R148G possibly damaging Het
Gm28363 G A 1: 117,698,849 V6I unknown Het
Gmps A G 3: 64,011,561 D522G probably damaging Het
Gpr75 T C 11: 30,892,687 S531P probably damaging Het
Hars2 G T 18: 36,790,561 E468D probably benign Het
Jph4 C A 14: 55,115,207 R23L probably damaging Het
Kctd12 T A 14: 102,981,794 Y216F probably benign Het
L3mbtl1 G A 2: 162,949,540 probably null Het
Lama4 G A 10: 38,965,733 probably benign Het
Lyst T A 13: 13,752,090 S3494T possibly damaging Het
Mybpc2 A G 7: 44,506,193 S879P probably benign Het
Ncaph C T 2: 127,122,114 V304M probably benign Het
Olfr1061 T A 2: 86,413,351 K234* probably null Het
Olfr1209 T C 2: 88,909,859 D178G probably damaging Het
Olfr964-ps1 T C 9: 39,686,435 M170V unknown Het
Pald1 A T 10: 61,347,066 V368E probably damaging Het
Pde9a T A 17: 31,459,097 M217K probably damaging Het
Pitpnm2 G T 5: 124,121,303 A1323E probably benign Het
Ppp1r32 T A 19: 10,482,338 M2L probably benign Het
Ppp1r3a T C 6: 14,719,191 S575G probably benign Het
Prok1 T C 3: 107,239,625 I9V probably benign Het
Ptprc A T 1: 138,071,180 V905D probably damaging Het
Rbm25 G T 12: 83,663,998 G295V unknown Het
Rreb1 T C 13: 37,916,568 M225T possibly damaging Het
Ryr3 T C 2: 113,028,644 K55E probably damaging Het
Scgb2b26 G T 7: 33,944,954 T4K probably damaging Het
Setx C A 2: 29,148,172 D1556E probably benign Het
Sft2d1 C T 17: 8,323,332 T136I possibly damaging Het
Sirt5 C T 13: 43,371,904 A63V possibly damaging Het
Skor2 A G 18: 76,859,809 T409A possibly damaging Het
Slc12a6 T C 2: 112,334,415 M153T probably benign Het
Slc17a2 A G 13: 23,822,365 Y458C probably damaging Het
Slc36a2 A G 11: 55,162,657 V385A possibly damaging Het
St6galnac5 A T 3: 152,846,494 H145Q probably damaging Het
Tal1 T A 4: 115,068,413 N226K probably damaging Het
Tgtp2 G C 11: 49,059,308 R146G probably damaging Het
Uhrf1bp1l T C 10: 89,779,882 V129A probably damaging Het
Usp6nl T C 2: 6,440,519 S436P probably benign Het
Utp3 A G 5: 88,554,762 E50G probably benign Het
Zfp12 A T 5: 143,239,994 Q19L probably damaging Het
Other mutations in Noto
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:Noto APN 6 85424210 missense probably benign 0.01
IGL03081:Noto APN 6 85424109 missense probably damaging 1.00
R1837:Noto UTSW 6 85424177 missense probably benign 0.00
R6898:Noto UTSW 6 85427960 missense probably damaging 1.00
R7476:Noto UTSW 6 85425499 missense probably damaging 1.00
RF003:Noto UTSW 6 85424210 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCGGTGACTGAGAACTTAGG -3'
(R):5'- TATGCTGCTTCCAGAGTTCC -3'

Sequencing Primer
(F):5'- CTGAGAACTTAGGAATGACATTTGG -3'
(R):5'- GAGTTCCCTTGCTTGATTGTCCAAG -3'
Posted On2019-06-26