Incidental Mutation 'R7188:Cd177'
ID559425
Institutional Source Beutler Lab
Gene Symbol Cd177
Ensembl Gene ENSMUSG00000052212
Gene NameCD177 antigen
SynonymsPdp3, 1190003K14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.485) question?
Stock #R7188 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location24743983-24760311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 24756647 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 232 (T232K)
Ref Sequence ENSEMBL: ENSMUSP00000064934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063956]
Predicted Effect probably damaging
Transcript: ENSMUST00000063956
AA Change: T232K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064934
Gene: ENSMUSG00000052212
AA Change: T232K

DomainStartEndE-ValueType
Pfam:UPAR_LY6 134 214 3.7e-11 PFAM
Pfam:UPAR_LY6 226 300 1.2e-4 PFAM
low complexity region 301 317 N/A INTRINSIC
Pfam:UPAR_LY6 322 400 1.5e-9 PFAM
Pfam:UPAR_LY6 511 586 9.1e-12 PFAM
Pfam:UPAR_LY6 705 782 1.4e-11 PFAM
low complexity region 795 811 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosyl-phosphatidylinositol (GPI)-linked cell surface glycoprotein that plays a role in neutrophil activation. The protein can bind platelet endothelial cell adhesion molecule-1 and function in neutrophil transmigration. Mutations in this gene are associated with myeloproliferative diseases. Over-expression of this gene has been found in patients with polycythemia rubra vera. Autoantibodies against the protein may result in pulmonary transfusion reactions, and it may be involved in Wegener's granulomatosis. A related pseudogene, which is adjacent to this gene on chromosome 19, has been identified. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased circulating neutrophils, increased neutrophil cell death and decreased neutrophils and monocytes early after S. aureus infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 36,950,013 T1624S probably benign Het
Abca17 T C 17: 24,335,626 Y118C possibly damaging Het
Abcb6 A G 1: 75,174,137 probably null Het
Acox2 T A 14: 8,252,996 I236L possibly damaging Het
Adamts12 A T 15: 11,336,325 K1499* probably null Het
Ankrd24 G T 10: 81,636,390 E20* probably null Het
Arsa A T 15: 89,475,627 Y32* probably null Het
Atp9b A G 18: 80,917,826 S57P Het
Atr G T 9: 95,862,791 E54* probably null Het
Bace1 A G 9: 45,856,095 D192G probably benign Het
Cacna1d T C 14: 30,089,833 S1309G probably benign Het
Chil4 T A 3: 106,204,159 D213V probably damaging Het
Cmya5 A T 13: 93,046,038 I3538N probably damaging Het
Cyp26a1 T A 19: 37,699,305 M287K possibly damaging Het
Dcaf5 T C 12: 80,399,958 D129G probably damaging Het
Dnah12 A C 14: 26,814,413 K2095N probably benign Het
Dnpep G A 1: 75,316,057 S106L probably damaging Het
Dock2 C T 11: 34,239,675 E1499K possibly damaging Het
Dus4l A G 12: 31,646,715 F88L probably damaging Het
Fcrls A C 3: 87,259,523 D54E probably benign Het
Fign T A 2: 63,979,606 H440L possibly damaging Het
Gabpa A G 16: 84,846,286 D157G probably damaging Het
Gapdh T A 6: 125,165,440 probably benign Het
Gbp8 G T 5: 105,016,215 R406S probably benign Het
Gm15922 A T 7: 3,738,829 V184E probably damaging Het
Gm21775 A G Y: 10,553,894 R148G possibly damaging Het
Gm28363 G A 1: 117,698,849 V6I unknown Het
Gmps A G 3: 64,011,561 D522G probably damaging Het
Gpr75 T C 11: 30,892,687 S531P probably damaging Het
Hars2 G T 18: 36,790,561 E468D probably benign Het
Jph4 C A 14: 55,115,207 R23L probably damaging Het
Kctd12 T A 14: 102,981,794 Y216F probably benign Het
L3mbtl1 G A 2: 162,949,540 probably null Het
Lama4 G A 10: 38,965,733 probably benign Het
Lyst T A 13: 13,752,090 S3494T possibly damaging Het
Mybpc2 A G 7: 44,506,193 S879P probably benign Het
Ncaph C T 2: 127,122,114 V304M probably benign Het
Noto A T 6: 85,428,065 I229F possibly damaging Het
Olfr1061 T A 2: 86,413,351 K234* probably null Het
Olfr1209 T C 2: 88,909,859 D178G probably damaging Het
Olfr964-ps1 T C 9: 39,686,435 M170V unknown Het
Pald1 A T 10: 61,347,066 V368E probably damaging Het
Pde9a T A 17: 31,459,097 M217K probably damaging Het
Pitpnm2 G T 5: 124,121,303 A1323E probably benign Het
Ppp1r32 T A 19: 10,482,338 M2L probably benign Het
Ppp1r3a T C 6: 14,719,191 S575G probably benign Het
Prok1 T C 3: 107,239,625 I9V probably benign Het
Ptprc A T 1: 138,071,180 V905D probably damaging Het
Rbm25 G T 12: 83,663,998 G295V unknown Het
Rreb1 T C 13: 37,916,568 M225T possibly damaging Het
Ryr3 T C 2: 113,028,644 K55E probably damaging Het
Scgb2b26 G T 7: 33,944,954 T4K probably damaging Het
Setx C A 2: 29,148,172 D1556E probably benign Het
Sft2d1 C T 17: 8,323,332 T136I possibly damaging Het
Sirt5 C T 13: 43,371,904 A63V possibly damaging Het
Skor2 A G 18: 76,859,809 T409A possibly damaging Het
Slc12a6 T C 2: 112,334,415 M153T probably benign Het
Slc17a2 A G 13: 23,822,365 Y458C probably damaging Het
Slc36a2 A G 11: 55,162,657 V385A possibly damaging Het
St6galnac5 A T 3: 152,846,494 H145Q probably damaging Het
Tal1 T A 4: 115,068,413 N226K probably damaging Het
Tgtp2 G C 11: 49,059,308 R146G probably damaging Het
Uhrf1bp1l T C 10: 89,779,882 V129A probably damaging Het
Usp6nl T C 2: 6,440,519 S436P probably benign Het
Utp3 A G 5: 88,554,762 E50G probably benign Het
Zfp12 A T 5: 143,239,994 Q19L probably damaging Het
Other mutations in Cd177
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Cd177 APN 7 24759751 missense possibly damaging 0.59
IGL00479:Cd177 APN 7 24758015 missense probably benign 0.05
IGL00673:Cd177 APN 7 24752017 missense possibly damaging 0.78
IGL00913:Cd177 APN 7 24756195 missense probably damaging 1.00
IGL01445:Cd177 APN 7 24752071 missense possibly damaging 0.95
IGL02021:Cd177 APN 7 24745206 missense probably benign 0.16
IGL02134:Cd177 APN 7 24752352 missense probably benign 0.01
IGL02532:Cd177 APN 7 24745249 missense probably benign 0.30
IGL02821:Cd177 APN 7 24744393 missense probably damaging 1.00
IGL02821:Cd177 APN 7 24744394 missense probably damaging 1.00
IGL02888:Cd177 APN 7 24758437 missense probably damaging 0.99
R0506:Cd177 UTSW 7 24758356 missense probably damaging 1.00
R0601:Cd177 UTSW 7 24752313 missense probably benign 0.00
R0631:Cd177 UTSW 7 24756686 missense probably benign 0.03
R0713:Cd177 UTSW 7 24744430 missense probably benign 0.25
R1595:Cd177 UTSW 7 24744964 missense probably benign
R1659:Cd177 UTSW 7 24746137 missense probably damaging 1.00
R2258:Cd177 UTSW 7 24756236 missense possibly damaging 0.73
R2260:Cd177 UTSW 7 24756236 missense possibly damaging 0.73
R2379:Cd177 UTSW 7 24758043 missense possibly damaging 0.80
R2763:Cd177 UTSW 7 24758037 missense probably benign 0.05
R2929:Cd177 UTSW 7 24754279 nonsense probably null
R3815:Cd177 UTSW 7 24754392 missense probably benign 0.00
R3818:Cd177 UTSW 7 24754392 missense probably benign 0.00
R3919:Cd177 UTSW 7 24744433 missense probably benign 0.15
R4300:Cd177 UTSW 7 24750420 missense possibly damaging 0.48
R4494:Cd177 UTSW 7 24752003 missense probably benign 0.06
R4781:Cd177 UTSW 7 24750626 missense probably damaging 1.00
R4819:Cd177 UTSW 7 24752271 missense probably damaging 1.00
R5062:Cd177 UTSW 7 24744316 missense probably benign 0.03
R5186:Cd177 UTSW 7 24744923 missense probably benign 0.31
R5285:Cd177 UTSW 7 24746249 missense probably benign 0.00
R5415:Cd177 UTSW 7 24752391 missense probably damaging 1.00
R5577:Cd177 UTSW 7 24745137 missense probably damaging 1.00
R5637:Cd177 UTSW 7 24756323 missense probably benign 0.01
R5673:Cd177 UTSW 7 24750362 missense probably damaging 1.00
R5731:Cd177 UTSW 7 24744421 missense probably damaging 1.00
R5775:Cd177 UTSW 7 24752268 missense probably damaging 1.00
R5840:Cd177 UTSW 7 24758070 missense probably damaging 0.99
R5870:Cd177 UTSW 7 24756332 missense probably benign 0.00
R5872:Cd177 UTSW 7 24752263 missense probably null 1.00
R6148:Cd177 UTSW 7 24744273 nonsense probably null
R6505:Cd177 UTSW 7 24744246 missense probably benign 0.00
R6897:Cd177 UTSW 7 24745074 missense probably benign 0.31
R7023:Cd177 UTSW 7 24759762 missense probably benign 0.44
R7088:Cd177 UTSW 7 24745133 nonsense probably null
R7366:Cd177 UTSW 7 24756722 missense probably damaging 1.00
R7744:Cd177 UTSW 7 24750375 missense probably damaging 1.00
R8008:Cd177 UTSW 7 24752349 missense not run
R8029:Cd177 UTSW 7 24756169 nonsense probably null
R8030:Cd177 UTSW 7 24756169 nonsense probably null
R8032:Cd177 UTSW 7 24756169 nonsense probably null
Z1176:Cd177 UTSW 7 24746171 missense not run
Z1177:Cd177 UTSW 7 24760256 missense not run
Predicted Primers PCR Primer
(F):5'- CTGACCAGGCAGAACTGATG -3'
(R):5'- GCATCAGAGATGGTCCACAC -3'

Sequencing Primer
(F):5'- CTGATGGGAGAGGATGCACC -3'
(R):5'- ACGGACCAACTTGTCAGTG -3'
Posted On2019-06-26