Incidental Mutation 'R0590:Ccdc191'
ID 55943
Institutional Source Beutler Lab
Gene Symbol Ccdc191
Ensembl Gene ENSMUSG00000022701
Gene Name coiled-coil domain containing 191
Synonyms 2610015P09Rik
MMRRC Submission 038780-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.201) question?
Stock # R0590 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 43710172-43784677 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 43751704 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 345 (R345*)
Ref Sequence ENSEMBL: ENSMUSP00000137597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122014] [ENSMUST00000132859] [ENSMUST00000178400]
AlphaFold J3QQ27
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122014
SMART Domains Protein: ENSMUSP00000112569
Gene: ENSMUSG00000022701

DomainStartEndE-ValueType
coiled coil region 202 241 N/A INTRINSIC
coiled coil region 275 295 N/A INTRINSIC
coiled coil region 336 366 N/A INTRINSIC
low complexity region 407 426 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000132859
AA Change: R287*
SMART Domains Protein: ENSMUSP00000116078
Gene: ENSMUSG00000022701
AA Change: R287*

DomainStartEndE-ValueType
coiled coil region 144 183 N/A INTRINSIC
coiled coil region 217 237 N/A INTRINSIC
coiled coil region 278 308 N/A INTRINSIC
low complexity region 349 368 N/A INTRINSIC
coiled coil region 471 504 N/A INTRINSIC
coiled coil region 568 641 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146343
Predicted Effect probably null
Transcript: ENSMUST00000178400
AA Change: R345*
SMART Domains Protein: ENSMUSP00000137597
Gene: ENSMUSG00000022701
AA Change: R345*

DomainStartEndE-ValueType
coiled coil region 202 241 N/A INTRINSIC
coiled coil region 275 295 N/A INTRINSIC
coiled coil region 336 366 N/A INTRINSIC
low complexity region 407 426 N/A INTRINSIC
coiled coil region 529 562 N/A INTRINSIC
coiled coil region 626 699 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acnat2 C T 4: 49,383,273 (GRCm39) M93I probably benign Het
Adamts16 T C 13: 70,949,073 (GRCm39) D196G probably benign Het
Adhfe1 T A 1: 9,618,378 (GRCm39) probably null Het
AI661453 A G 17: 47,777,999 (GRCm39) probably benign Het
Apc G T 18: 34,449,283 (GRCm39) E2026* probably null Het
Atg2a GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC 19: 6,295,037 (GRCm39) probably benign Het
Cad T C 5: 31,219,575 (GRCm39) S688P probably damaging Het
Dcaf13 T A 15: 39,008,480 (GRCm39) probably benign Het
Drc1 A G 5: 30,520,480 (GRCm39) D607G probably benign Het
Fhip1a T C 3: 85,579,683 (GRCm39) R841G probably benign Het
Gli1 G T 10: 127,167,432 (GRCm39) A607E possibly damaging Het
Gls G A 1: 52,251,534 (GRCm39) probably benign Het
Gria1 A T 11: 57,180,235 (GRCm39) Q728H probably damaging Het
Hcrtr1 A G 4: 130,029,487 (GRCm39) L198P probably damaging Het
Ifngr1 T A 10: 19,479,690 (GRCm39) probably benign Het
Ipo5 T C 14: 121,181,769 (GRCm39) V954A possibly damaging Het
Kcnh5 G T 12: 75,012,035 (GRCm39) A628D probably damaging Het
Kif14 T C 1: 136,410,210 (GRCm39) S646P probably damaging Het
Ksr1 A G 11: 78,935,966 (GRCm39) S133P probably damaging Het
Neb T C 2: 52,027,302 (GRCm39) M7143V probably damaging Het
Nelfa G A 5: 34,059,169 (GRCm39) P229S probably damaging Het
Nfatc2 T C 2: 168,413,119 (GRCm39) T169A probably damaging Het
Nr1h4 A G 10: 89,292,429 (GRCm39) Y398H probably damaging Het
Nrcam A G 12: 44,610,815 (GRCm39) E511G probably damaging Het
Ocstamp T A 2: 165,239,671 (GRCm39) R172W probably damaging Het
Or10ag60 A G 2: 87,438,338 (GRCm39) E202G probably damaging Het
Or8d1 T A 9: 38,766,766 (GRCm39) M136K probably damaging Het
Or8g19 T C 9: 39,056,017 (GRCm39) V207A probably benign Het
Phf14 G A 6: 11,961,577 (GRCm39) V405I possibly damaging Het
Plk5 G A 10: 80,196,057 (GRCm39) R238H probably damaging Het
Pole A G 5: 110,465,792 (GRCm39) E1240G probably benign Het
Prdm15 A G 16: 97,598,961 (GRCm39) I899T possibly damaging Het
Psip1 T C 4: 83,376,381 (GRCm39) N486S probably benign Het
Rlf A G 4: 121,028,030 (GRCm39) probably benign Het
Rttn T C 18: 88,997,759 (GRCm39) S255P probably damaging Het
Rusf1 A G 7: 127,896,642 (GRCm39) L134P probably damaging Het
Sema6c A G 3: 95,079,934 (GRCm39) K711E probably damaging Het
Slc4a10 A T 2: 62,021,237 (GRCm39) probably benign Het
Trim36 T G 18: 46,305,643 (GRCm39) S435R probably benign Het
Ucp1 A G 8: 84,018,232 (GRCm39) probably benign Het
Vmn1r17 T C 6: 57,337,999 (GRCm39) Y122C probably benign Het
Vmn1r23 A G 6: 57,903,349 (GRCm39) V143A probably benign Het
Wdfy4 T A 14: 32,763,131 (GRCm39) Q2166L probably benign Het
Zc3h7b C T 15: 81,661,199 (GRCm39) T346M possibly damaging Het
Zfhx4 T A 3: 5,467,693 (GRCm39) V2617D probably damaging Het
Other mutations in Ccdc191
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01629:Ccdc191 APN 16 43,779,663 (GRCm39) missense possibly damaging 0.81
IGL02272:Ccdc191 APN 16 43,780,385 (GRCm39) missense possibly damaging 0.85
IGL02473:Ccdc191 APN 16 43,777,257 (GRCm39) missense probably benign 0.03
IGL02660:Ccdc191 APN 16 43,780,462 (GRCm39) missense probably benign 0.11
LCD18:Ccdc191 UTSW 16 43,742,164 (GRCm39) intron probably benign
R0238:Ccdc191 UTSW 16 43,767,859 (GRCm39) nonsense probably null
R0238:Ccdc191 UTSW 16 43,767,859 (GRCm39) nonsense probably null
R0346:Ccdc191 UTSW 16 43,759,315 (GRCm39) missense probably damaging 0.99
R0907:Ccdc191 UTSW 16 43,735,901 (GRCm39) missense probably benign 0.03
R0930:Ccdc191 UTSW 16 43,751,618 (GRCm39) missense probably damaging 1.00
R1761:Ccdc191 UTSW 16 43,763,873 (GRCm39) missense probably benign 0.01
R2127:Ccdc191 UTSW 16 43,728,998 (GRCm39) missense probably benign 0.00
R2408:Ccdc191 UTSW 16 43,751,561 (GRCm39) missense probably benign 0.08
R2567:Ccdc191 UTSW 16 43,764,330 (GRCm39) splice site probably null
R3104:Ccdc191 UTSW 16 43,751,573 (GRCm39) missense probably damaging 1.00
R3105:Ccdc191 UTSW 16 43,751,573 (GRCm39) missense probably damaging 1.00
R3106:Ccdc191 UTSW 16 43,751,573 (GRCm39) missense probably damaging 1.00
R4319:Ccdc191 UTSW 16 43,767,872 (GRCm39) missense probably damaging 1.00
R4320:Ccdc191 UTSW 16 43,767,872 (GRCm39) missense probably damaging 1.00
R4323:Ccdc191 UTSW 16 43,767,872 (GRCm39) missense probably damaging 1.00
R4324:Ccdc191 UTSW 16 43,767,872 (GRCm39) missense probably damaging 1.00
R4667:Ccdc191 UTSW 16 43,751,646 (GRCm39) missense probably damaging 1.00
R4676:Ccdc191 UTSW 16 43,759,536 (GRCm39) splice site probably benign
R4788:Ccdc191 UTSW 16 43,777,185 (GRCm39) missense probably damaging 1.00
R4976:Ccdc191 UTSW 16 43,763,868 (GRCm39) missense probably benign 0.17
R5557:Ccdc191 UTSW 16 43,728,976 (GRCm39) missense probably damaging 1.00
R6369:Ccdc191 UTSW 16 43,735,848 (GRCm39) missense probably benign 0.05
R7459:Ccdc191 UTSW 16 43,767,820 (GRCm39) nonsense probably null
R7543:Ccdc191 UTSW 16 43,718,572 (GRCm39) nonsense probably null
R7843:Ccdc191 UTSW 16 43,779,699 (GRCm39) missense probably damaging 1.00
R8077:Ccdc191 UTSW 16 43,735,968 (GRCm39) critical splice donor site probably null
R8474:Ccdc191 UTSW 16 43,710,262 (GRCm39) start gained probably benign
R8984:Ccdc191 UTSW 16 43,710,581 (GRCm39) intron probably benign
R8987:Ccdc191 UTSW 16 43,751,710 (GRCm39) missense probably benign 0.29
R9108:Ccdc191 UTSW 16 43,718,512 (GRCm39) missense possibly damaging 0.92
R9222:Ccdc191 UTSW 16 43,725,831 (GRCm39) missense probably damaging 1.00
R9276:Ccdc191 UTSW 16 43,764,041 (GRCm39) nonsense probably null
R9448:Ccdc191 UTSW 16 43,759,338 (GRCm39) missense
R9507:Ccdc191 UTSW 16 43,764,192 (GRCm39) missense probably damaging 0.99
R9757:Ccdc191 UTSW 16 43,762,170 (GRCm39) missense
Z1177:Ccdc191 UTSW 16 43,759,485 (GRCm39) missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- AAAGGGCTGTCAGTGTGGCATATC -3'
(R):5'- GGCCTCAGACAATCTGCTTCACTTC -3'

Sequencing Primer
(F):5'- CTGTCAGTGTGGCATATCTGAAAC -3'
(R):5'- TAACATAGAAGAACAGGTCACTGTC -3'
Posted On 2013-07-11