Mutagenetix > Incidental Mutation

Incidental Mutation 'R7188:Adamts12'

559452

Institutional Source

Beutler Lab

Gene Symbol

Adamts12

Ensembl Gene

ENSMUSG00000047497

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 12

Synonyms

AI605170; ADAMTS-12

MMRRC Submission

Accession Numbers

Genbank: NM_175501.2; MGI:2146046

Essential gene?

Probably non essential (E-score: 0.088) question?

Stock #

R7188 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

11064790-11349231 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 11336325 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 1499 (K1499*)

Ref Sequence

ENSEMBL: ENSMUSP00000057796 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061318]

AlphaFold

Q811B3

Predicted Effect

probably null
Transcript: ENSMUST00000061318
AA Change: K1499*

SMART Domains

Protein: ENSMUSP00000057796
Gene: ENSMUSG00000047497
AA Change: K1499*

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:Pep_M12B_propep	53	197	5.5e-30	PFAM
low complexity region	236	245	N/A	INTRINSIC
Pfam:Reprolysin_5	248	438	1.6e-14	PFAM
Pfam:Reprolysin_4	248	453	6.7e-8	PFAM
Pfam:Reprolysin	250	460	1.2e-27	PFAM
Pfam:Reprolysin_2	268	450	5.5e-11	PFAM
Pfam:Reprolysin_3	272	407	3.5e-10	PFAM
TSP1	549	601	9.29e-14	SMART
Pfam:ADAM_spacer1	706	817	4.8e-36	PFAM
TSP1	831	887	4.66e-5	SMART
TSP1	890	949	2.54e-1	SMART
TSP1	951	1001	8.95e-7	SMART
low complexity region	1032	1047	N/A	INTRINSIC
low complexity region	1130	1141	N/A	INTRINSIC
TSP1	1321	1371	2.22e-2	SMART
TSP1	1372	1431	9.97e-2	SMART
TSP1	1432	1479	1.19e-2	SMART
TSP1	1480	1538	2.63e-4	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active protease. Mice lacking the encoded protein exhibit increased angiogenic response and tumor invasion in different models of angiogenesis and, severe inflammation and delayed recovery when subjected to experimental conditions that induce colitis, endotoxic sepsis and pancreatitis. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased tumor vascularization, tumor invasion, and angiogenesis. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	A	T	3: 36,950,013	T1624S	probably benign	Het
Abca17	T	C	17: 24,335,626	Y118C	possibly damaging	Het
Abcb6	A	G	1: 75,174,137		probably null	Het
Acox2	T	A	14: 8,252,996	I236L	possibly damaging	Het
Ankrd24	G	T	10: 81,636,390	E20*	probably null	Het
Arsa	A	T	15: 89,475,627	Y32*	probably null	Het
Atp9b	A	G	18: 80,917,826	S57P		Het
Atr	G	T	9: 95,862,791	E54*	probably null	Het
Bace1	A	G	9: 45,856,095	D192G	probably benign	Het
Cacna1d	T	C	14: 30,089,833	S1309G	probably benign	Het
Cd177	G	T	7: 24,756,647	T232K	probably damaging	Het
Chil4	T	A	3: 106,204,159	D213V	probably damaging	Het
Cmya5	A	T	13: 93,046,038	I3538N	probably damaging	Het
Cyp26a1	T	A	19: 37,699,305	M287K	possibly damaging	Het
Dcaf5	T	C	12: 80,399,958	D129G	probably damaging	Het
Dnah12	A	C	14: 26,814,413	K2095N	probably benign	Het
Dnpep	G	A	1: 75,316,057	S106L	probably damaging	Het
Dock2	C	T	11: 34,239,675	E1499K	possibly damaging	Het
Dus4l	A	G	12: 31,646,715	F88L	probably damaging	Het
Fcrls	A	C	3: 87,259,523	D54E	probably benign	Het
Fign	T	A	2: 63,979,606	H440L	possibly damaging	Het
Gabpa	A	G	16: 84,846,286	D157G	probably damaging	Het
Gapdh	T	A	6: 125,165,440		probably benign	Het
Gbp8	G	T	5: 105,016,215	R406S	probably benign	Het
Gm15922	A	T	7: 3,738,829	V184E	probably damaging	Het
Gm21775	A	G	Y: 10,553,894	R148G	possibly damaging	Het
Gm28363	G	A	1: 117,698,849	V6I	unknown	Het
Gmps	A	G	3: 64,011,561	D522G	probably damaging	Het
Gpr75	T	C	11: 30,892,687	S531P	probably damaging	Het
Hars2	G	T	18: 36,790,561	E468D	probably benign	Het
Jph4	C	A	14: 55,115,207	R23L	probably damaging	Het
Kctd12	T	A	14: 102,981,794	Y216F	probably benign	Het
L3mbtl1	G	A	2: 162,949,540		probably null	Het
Lama4	G	A	10: 38,965,733		probably benign	Het
Lyst	T	A	13: 13,752,090	S3494T	possibly damaging	Het
Mybpc2	A	G	7: 44,506,193	S879P	probably benign	Het
Ncaph	C	T	2: 127,122,114	V304M	probably benign	Het
Noto	A	T	6: 85,428,065	I229F	possibly damaging	Het
Olfr1061	T	A	2: 86,413,351	K234*	probably null	Het
Olfr1209	T	C	2: 88,909,859	D178G	probably damaging	Het
Olfr964-ps1	T	C	9: 39,686,435	M170V	unknown	Het
Pald1	A	T	10: 61,347,066	V368E	probably damaging	Het
Pde9a	T	A	17: 31,459,097	M217K	probably damaging	Het
Pitpnm2	G	T	5: 124,121,303	A1323E	probably benign	Het
Ppp1r32	T	A	19: 10,482,338	M2L	probably benign	Het
Ppp1r3a	T	C	6: 14,719,191	S575G	probably benign	Het
Prok1	T	C	3: 107,239,625	I9V	probably benign	Het
Ptprc	A	T	1: 138,071,180	V905D	probably damaging	Het
Rbm25	G	T	12: 83,663,998	G295V	unknown	Het
Rreb1	T	C	13: 37,916,568	M225T	possibly damaging	Het
Ryr3	T	C	2: 113,028,644	K55E	probably damaging	Het
Scgb2b26	G	T	7: 33,944,954	T4K	probably damaging	Het
Setx	C	A	2: 29,148,172	D1556E	probably benign	Het
Sft2d1	C	T	17: 8,323,332	T136I	possibly damaging	Het
Sirt5	C	T	13: 43,371,904	A63V	possibly damaging	Het
Skor2	A	G	18: 76,859,809	T409A	possibly damaging	Het
Slc12a6	T	C	2: 112,334,415	M153T	probably benign	Het
Slc17a2	A	G	13: 23,822,365	Y458C	probably damaging	Het
Slc36a2	A	G	11: 55,162,657	V385A	possibly damaging	Het
St6galnac5	A	T	3: 152,846,494	H145Q	probably damaging	Het
Tal1	T	A	4: 115,068,413	N226K	probably damaging	Het
Tgtp2	G	C	11: 49,059,308	R146G	probably damaging	Het
Uhrf1bp1l	T	C	10: 89,779,882	V129A	probably damaging	Het
Usp6nl	T	C	2: 6,440,519	S436P	probably benign	Het
Utp3	A	G	5: 88,554,762	E50G	probably benign	Het
Zfp12	A	T	5: 143,239,994	Q19L	probably damaging	Het

Other mutations in Adamts12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Adamts12	APN	15	11311599	missense	probably benign	0.00
IGL00513:Adamts12	APN	15	11256961	missense	probably benign	0.28
IGL00579:Adamts12	APN	15	11152014	missense	probably benign	0.20
IGL00984:Adamts12	APN	15	11215610	missense	probably benign	0.01
IGL01307:Adamts12	APN	15	11237546	missense	possibly damaging	0.88
IGL01314:Adamts12	APN	15	11071853	missense	probably benign	0.30
IGL01353:Adamts12	APN	15	11292005	splice site	probably benign
IGL01373:Adamts12	APN	15	11310730	missense	probably benign	0.00
IGL01522:Adamts12	APN	15	11065159	critical splice donor site	probably null
IGL01589:Adamts12	APN	15	11311237	missense	probably benign	0.26
IGL01715:Adamts12	APN	15	11258096	missense	possibly damaging	0.47
IGL01966:Adamts12	APN	15	11258183	missense	probably damaging	0.98
IGL01994:Adamts12	APN	15	11345594	missense	probably damaging	1.00
IGL02058:Adamts12	APN	15	11215610	missense	probably benign	0.01
IGL02216:Adamts12	APN	15	11241485	missense	possibly damaging	0.63
IGL02252:Adamts12	APN	15	11311015	missense	probably benign	0.01
IGL02336:Adamts12	APN	15	11311245	missense	probably benign	0.02
IGL02445:Adamts12	APN	15	11286712	missense	probably damaging	1.00
IGL03115:Adamts12	APN	15	11263336	missense	probably damaging	1.00
IGL03131:Adamts12	APN	15	11345564	missense	probably damaging	1.00
IGL03161:Adamts12	APN	15	11292082	missense	possibly damaging	0.93
IGL03403:Adamts12	APN	15	11241488	missense	probably damaging	1.00
I2289:Adamts12	UTSW	15	11071808	missense	probably benign	0.13
PIT4677001:Adamts12	UTSW	15	11286810	missense	probably benign	0.33
R0016:Adamts12	UTSW	15	11217829	missense	probably damaging	1.00
R0016:Adamts12	UTSW	15	11217829	missense	probably damaging	1.00
R0027:Adamts12	UTSW	15	11285873	missense	probably damaging	0.99
R0027:Adamts12	UTSW	15	11285873	missense	probably damaging	0.99
R0028:Adamts12	UTSW	15	11215624	missense	probably damaging	1.00
R0108:Adamts12	UTSW	15	11311098	missense	probably benign	0.08
R0108:Adamts12	UTSW	15	11311098	missense	probably benign	0.08
R0122:Adamts12	UTSW	15	11215624	missense	probably damaging	1.00
R0196:Adamts12	UTSW	15	11071508	missense	probably benign	0.11
R0308:Adamts12	UTSW	15	11311560	missense	probably damaging	0.98
R0335:Adamts12	UTSW	15	11311058	missense	possibly damaging	0.95
R0667:Adamts12	UTSW	15	11215624	missense	probably damaging	1.00
R0729:Adamts12	UTSW	15	11255683	missense	possibly damaging	0.91
R1162:Adamts12	UTSW	15	11277458	critical splice donor site	probably null
R1173:Adamts12	UTSW	15	11071757	missense	probably benign
R1174:Adamts12	UTSW	15	11071757	missense	probably benign
R1319:Adamts12	UTSW	15	11286791	missense	probably benign	0.02
R1344:Adamts12	UTSW	15	11286804	missense	probably damaging	1.00
R1367:Adamts12	UTSW	15	11256894	splice site	probably benign
R1396:Adamts12	UTSW	15	11311472	missense	probably benign	0.01
R1418:Adamts12	UTSW	15	11286804	missense	probably damaging	1.00
R1447:Adamts12	UTSW	15	11263361	missense	probably benign	0.42
R1466:Adamts12	UTSW	15	11311359	missense	probably benign
R1466:Adamts12	UTSW	15	11311359	missense	probably benign
R1599:Adamts12	UTSW	15	11071711	missense	probably damaging	0.99
R1700:Adamts12	UTSW	15	11152057	missense	probably benign	0.00
R1748:Adamts12	UTSW	15	11241462	missense	probably damaging	0.99
R1826:Adamts12	UTSW	15	11071520	missense	probably benign	0.06
R1870:Adamts12	UTSW	15	11311154	missense	probably benign	0.06
R1871:Adamts12	UTSW	15	11311154	missense	probably benign	0.06
R1872:Adamts12	UTSW	15	11217880	nonsense	probably null
R1931:Adamts12	UTSW	15	11270599	missense	probably benign	0.00
R2041:Adamts12	UTSW	15	11215735	missense	probably damaging	1.00
R2119:Adamts12	UTSW	15	11310579	missense	probably damaging	1.00
R2120:Adamts12	UTSW	15	11310579	missense	probably damaging	1.00
R2122:Adamts12	UTSW	15	11310579	missense	probably damaging	1.00
R2161:Adamts12	UTSW	15	11215735	missense	probably damaging	0.99
R2655:Adamts12	UTSW	15	11065088	missense	possibly damaging	0.50
R4010:Adamts12	UTSW	15	11286083	missense	possibly damaging	0.69
R4208:Adamts12	UTSW	15	11071754	missense	probably benign
R4666:Adamts12	UTSW	15	11311492	missense	probably benign	0.08
R4731:Adamts12	UTSW	15	11270662	missense	probably damaging	1.00
R4732:Adamts12	UTSW	15	11270662	missense	probably damaging	1.00
R4733:Adamts12	UTSW	15	11270662	missense	probably damaging	1.00
R4766:Adamts12	UTSW	15	11285901	missense	probably benign	0.03
R4877:Adamts12	UTSW	15	11327701	missense	probably damaging	1.00
R4929:Adamts12	UTSW	15	11259022	missense	probably damaging	0.96
R5060:Adamts12	UTSW	15	11299968	missense	probably damaging	1.00
R5145:Adamts12	UTSW	15	11285876	missense	probably damaging	1.00
R5191:Adamts12	UTSW	15	11327757	missense	probably benign	0.18
R5492:Adamts12	UTSW	15	11336298	missense	probably benign	0.05
R5580:Adamts12	UTSW	15	11152000	missense	probably benign	0.14
R5645:Adamts12	UTSW	15	11277420	missense	possibly damaging	0.92
R5724:Adamts12	UTSW	15	11286750	missense	probably benign	0.15
R6240:Adamts12	UTSW	15	11285958	missense	probably benign	0.44
R6331:Adamts12	UTSW	15	11241433	missense	probably damaging	1.00
R6381:Adamts12	UTSW	15	11256994	missense	possibly damaging	0.93
R6393:Adamts12	UTSW	15	11255635	missense	probably damaging	0.97
R6419:Adamts12	UTSW	15	11215673	missense	possibly damaging	0.72
R6571:Adamts12	UTSW	15	11065101	missense	probably benign	0.00
R6821:Adamts12	UTSW	15	11152048	missense	probably benign	0.14
R6913:Adamts12	UTSW	15	11215692	missense	probably damaging	1.00
R6973:Adamts12	UTSW	15	11331780	nonsense	probably null
R7290:Adamts12	UTSW	15	11277366	missense	probably benign	0.08
R7307:Adamts12	UTSW	15	11217813	missense	probably damaging	1.00
R7376:Adamts12	UTSW	15	11277339	missense	possibly damaging	0.69
R7419:Adamts12	UTSW	15	11317279	missense	probably benign	0.00
R7484:Adamts12	UTSW	15	11345648	missense	probably benign	0.25
R7562:Adamts12	UTSW	15	11270611	missense	probably benign	0.01
R7653:Adamts12	UTSW	15	11257029	missense	probably benign	0.28
R7696:Adamts12	UTSW	15	11258138	missense	probably damaging	1.00
R7957:Adamts12	UTSW	15	11317212	missense	possibly damaging	0.96
R7980:Adamts12	UTSW	15	11263337	missense	probably damaging	1.00
R7992:Adamts12	UTSW	15	11310818	missense	probably benign
R8032:Adamts12	UTSW	15	11259103	critical splice donor site	probably null
R8109:Adamts12	UTSW	15	11331791	missense	probably benign	0.02
R8402:Adamts12	UTSW	15	11263290	missense	probably damaging	0.96
R8751:Adamts12	UTSW	15	11215727	missense	probably damaging	1.00
R8782:Adamts12	UTSW	15	11237592	missense	probably damaging	1.00
R8934:Adamts12	UTSW	15	11299929	missense	probably damaging	0.99
R8952:Adamts12	UTSW	15	11285979	missense	probably damaging	1.00
R8963:Adamts12	UTSW	15	11317357	critical splice donor site	probably null
R9042:Adamts12	UTSW	15	11152048	missense	probably benign	0.08
R9162:Adamts12	UTSW	15	11311635	missense	probably benign	0.29
R9190:Adamts12	UTSW	15	11336360	missense	probably benign	0.02
R9700:Adamts12	UTSW	15	11311356	missense	probably benign	0.04
R9748:Adamts12	UTSW	15	11310542	missense	probably damaging	0.99
V1662:Adamts12	UTSW	15	11071808	missense	probably benign	0.13
X0022:Adamts12	UTSW	15	11277448	missense	probably benign	0.30
Z1176:Adamts12	UTSW	15	11336383	missense	not run
Z1177:Adamts12	UTSW	15	11317324	missense	probably damaging	1.00
Z1177:Adamts12	UTSW	15	11336383	missense	not run

Predicted Primers

PCR Primer
(F):5'- AAACTCACGCCTTGGACTGATTC -3'
(R):5'- AACATTGTCTCCTCCACTGCAG -3'

Sequencing Primer
(F):5'- GGACTGATTCAGATTTCAATTACGGC -3'
(R):5'- CCTCCACTGCAGCCCTG -3'

Posted On

2019-06-26