Incidental Mutation 'R0590:Trim36'
ID55947
Institutional Source Beutler Lab
Gene Symbol Trim36
Ensembl Gene ENSMUSG00000033949
Gene Nametripartite motif-containing 36
SynonymsHaprin, D18Wsu100e
MMRRC Submission 038780-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.387) question?
Stock #R0590 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location46165302-46212607 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 46172576 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 435 (S435R)
Ref Sequence ENSEMBL: ENSMUSP00000129771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037011] [ENSMUST00000167364]
Predicted Effect probably benign
Transcript: ENSMUST00000037011
AA Change: S447R

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000037978
Gene: ENSMUSG00000033949
AA Change: S447R

DomainStartEndE-ValueType
RING 33 118 1.25e-5 SMART
BBOX 207 249 1.82e-7 SMART
Blast:BBC 256 381 5e-11 BLAST
FN3 418 498 1.32e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167364
AA Change: S435R

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000129771
Gene: ENSMUSG00000033949
AA Change: S435R

DomainStartEndE-ValueType
RING 21 106 1.25e-5 SMART
BBOX 195 237 1.82e-7 SMART
Blast:BBC 244 369 4e-11 BLAST
FN3 406 486 1.32e-1 SMART
Pfam:SPRY 560 704 1.7e-9 PFAM
Meta Mutation Damage Score 0.0641 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acnat2 C T 4: 49,383,273 M93I probably benign Het
Adamts16 T C 13: 70,800,954 D196G probably benign Het
Adhfe1 T A 1: 9,548,153 probably null Het
AI661453 A G 17: 47,467,074 probably benign Het
Apc G T 18: 34,316,230 E2026* probably null Het
Atg2a GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC 19: 6,245,007 probably benign Het
BC017158 A G 7: 128,297,470 L134P probably damaging Het
Cad T C 5: 31,062,231 S688P probably damaging Het
Ccdc191 C T 16: 43,931,341 R345* probably null Het
Dcaf13 T A 15: 39,145,085 probably benign Het
Drc1 A G 5: 30,363,136 D607G probably benign Het
Fam160a1 T C 3: 85,672,376 R841G probably benign Het
Gli1 G T 10: 127,331,563 A607E possibly damaging Het
Gls G A 1: 52,212,375 probably benign Het
Gria1 A T 11: 57,289,409 Q728H probably damaging Het
Hcrtr1 A G 4: 130,135,694 L198P probably damaging Het
Ifngr1 T A 10: 19,603,942 probably benign Het
Ipo5 T C 14: 120,944,357 V954A possibly damaging Het
Kcnh5 G T 12: 74,965,261 A628D probably damaging Het
Kif14 T C 1: 136,482,472 S646P probably damaging Het
Ksr1 A G 11: 79,045,140 S133P probably damaging Het
Neb T C 2: 52,137,290 M7143V probably damaging Het
Nelfa G A 5: 33,901,825 P229S probably damaging Het
Nfatc2 T C 2: 168,571,199 T169A probably damaging Het
Nr1h4 A G 10: 89,456,567 Y398H probably damaging Het
Nrcam A G 12: 44,564,032 E511G probably damaging Het
Ocstamp T A 2: 165,397,751 R172W probably damaging Het
Olfr1130 A G 2: 87,607,994 E202G probably damaging Het
Olfr26 T A 9: 38,855,470 M136K probably damaging Het
Olfr27 T C 9: 39,144,721 V207A probably benign Het
Phf14 G A 6: 11,961,578 V405I possibly damaging Het
Plk5 G A 10: 80,360,223 R238H probably damaging Het
Pole A G 5: 110,317,926 E1240G probably benign Het
Prdm15 A G 16: 97,797,761 I899T possibly damaging Het
Psip1 T C 4: 83,458,144 N486S probably benign Het
Rlf A G 4: 121,170,833 probably benign Het
Rttn T C 18: 88,979,635 S255P probably damaging Het
Sema6c A G 3: 95,172,623 K711E probably damaging Het
Slc4a10 A T 2: 62,190,893 probably benign Het
Ucp1 A G 8: 83,291,603 probably benign Het
Vmn1r17 T C 6: 57,361,014 Y122C probably benign Het
Vmn1r23 A G 6: 57,926,364 V143A probably benign Het
Wdfy4 T A 14: 33,041,174 Q2166L probably benign Het
Zc3h7b C T 15: 81,776,998 T346M possibly damaging Het
Zfhx4 T A 3: 5,402,633 V2617D probably damaging Het
Other mutations in Trim36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01710:Trim36 APN 18 46188388 splice site probably benign
IGL02728:Trim36 APN 18 46172602 missense probably benign 0.00
IGL03166:Trim36 APN 18 46212321 missense probably benign
IGL03209:Trim36 APN 18 46167508 missense probably benign
R0346:Trim36 UTSW 18 46199709 unclassified probably benign
R0426:Trim36 UTSW 18 46172525 missense probably damaging 0.97
R0463:Trim36 UTSW 18 46178456 missense possibly damaging 0.89
R0751:Trim36 UTSW 18 46196251 missense probably damaging 1.00
R1037:Trim36 UTSW 18 46196318 splice site probably benign
R1184:Trim36 UTSW 18 46196251 missense probably damaging 1.00
R1522:Trim36 UTSW 18 46186183 nonsense probably null
R1571:Trim36 UTSW 18 46172495 missense probably benign 0.01
R1687:Trim36 UTSW 18 46188657 missense possibly damaging 0.93
R2057:Trim36 UTSW 18 46196162 missense probably benign 0.02
R2103:Trim36 UTSW 18 46196082 missense probably benign
R2127:Trim36 UTSW 18 46212337 missense probably benign 0.27
R3853:Trim36 UTSW 18 46172372 splice site probably benign
R4209:Trim36 UTSW 18 46196124 missense probably benign 0.44
R4787:Trim36 UTSW 18 46172532 missense probably benign 0.10
R4810:Trim36 UTSW 18 46172469 missense probably benign 0.07
R4953:Trim36 UTSW 18 46196178 missense possibly damaging 0.90
R5107:Trim36 UTSW 18 46172638 missense probably benign
R5320:Trim36 UTSW 18 46167498 missense probably damaging 1.00
R5683:Trim36 UTSW 18 46169292 missense probably damaging 1.00
R5823:Trim36 UTSW 18 46169340 missense probably damaging 1.00
R6619:Trim36 UTSW 18 46188408 missense probably damaging 0.96
R7349:Trim36 UTSW 18 46169428 missense probably benign 0.29
R7814:Trim36 UTSW 18 46167624 missense possibly damaging 0.64
R7853:Trim36 UTSW 18 46172491 missense probably benign 0.14
R7936:Trim36 UTSW 18 46172491 missense probably benign 0.14
R8008:Trim36 UTSW 18 46172489 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- TGATGCCAATTTAGCCCCAATCGT -3'
(R):5'- TTTGCGGAGGGAAATGCTGTCTTAA -3'

Sequencing Primer
(F):5'- ATGGAGACACTCTACACTTCTGG -3'
(R):5'- GGGAAATGCTGTCTTAACATCG -3'
Posted On2013-07-11