Mutagenetix > Incidental Mutation

Incidental Mutation 'R7189:Plxna2'

559471

Institutional Source

Beutler Lab

Gene Symbol

Plxna2

Ensembl Gene

ENSMUSG00000026640

Gene Name

plexin A2

Synonyms

2810428A13Rik, OCT, PlexA2, Plxn2

MMRRC Submission

045238-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7189 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

194618218-194816869 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 194801058 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 1559 (R1559L)

Ref Sequence

ENSEMBL: ENSMUSP00000027952 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027952]

AlphaFold

P70207

PDB Structure

Plexin A2 / Semaphorin 6A complex [X-RAY DIFFRACTION]
Mouse Plexin A2 extracellular domain [X-RAY DIFFRACTION]
Mouse Plexin A2, extracellular domains 1-4 [X-RAY DIFFRACTION]
Plexin A2 in complex with Semaphorin 6A [X-RAY DIFFRACTION]
Complex of mouse Plexin A2 - Semaphorin 3A - Neuropilin-1 [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027952
AA Change: R1559L

PolyPhen 2 Score 0.584 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000027952
Gene: ENSMUSG00000026640
AA Change: R1559L

Domain	Start	End	E-Value	Type
low complexity region	16	29	N/A	INTRINSIC
Sema	50	492	1.65e-132	SMART
PSI	510	560	8e-12	SMART
PSI	655	702	6.35e-6	SMART
PSI	803	856	1.24e-8	SMART
IPT	857	952	6.36e-21	SMART
IPT	953	1038	1.02e-24	SMART
IPT	1040	1140	1.48e-21	SMART
IPT	1142	1237	8.81e-6	SMART
transmembrane domain	1238	1260	N/A	INTRINSIC
Pfam:Plexin_cytopl	1311	1864	1.9e-261	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

95% (57/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plexin-A family of semaphorin co-receptors. Semaphorins are a large family of secreted or membrane-bound proteins that mediate repulsive effects on axon pathfinding during nervous system development. A subset of semaphorins are recognized by plexin-A/neuropilin transmembrane receptor complexes, triggering a cellular signal transduction cascade that leads to axon repulsion. This plexin-A family member is thought to transduce signals from semaphorin-3A and -3C. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show abnormal granule cell migration in the adult cerebellum and aberrant projection of mossy fibers in hippocampal slices. Mice homozygous for an ENU-induced allele are smaller and show granule cell migration defects and mild ataxia with incomplete penetrance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abtb2	G	T	2: 103,567,516	A264S	probably benign	Het
Atr	G	T	9: 95,862,791	E54*	probably null	Het
Bmp4	A	G	14: 46,383,999	S363P	probably damaging	Het
Cfap54	C	A	10: 92,937,728	A2077S	unknown	Het
Chrna7	T	C	7: 63,106,027	D257G	probably damaging	Het
Chrnd	C	T	1: 87,191,058	R46W	probably damaging	Het
Cntn2	A	G	1: 132,517,086	I851T	probably damaging	Het
Col3a1	T	A	1: 45,333,657	I534K	unknown	Het
Cyp3a25	A	T	5: 146,003,060	L46I	probably benign	Het
Dnah7b	G	C	1: 46,242,142	G2788R	probably damaging	Het
Dnpep	T	C	1: 75,313,430	E301G	probably damaging	Het
Efcab3	T	C	11: 105,095,864	S30P	probably benign	Het
Elk4	A	G	1: 132,019,389	I373V	probably damaging	Het
Fam161b	T	C	12: 84,348,646	S508G	probably damaging	Het
Fam198b	T	A	3: 79,886,807	L194*	probably null	Het
Fam214a	T	C	9: 75,004,351	C42R	probably damaging	Het
Fam71d	C	T	12: 78,712,208	P101S	probably benign	Het
Fgf10	A	G	13: 118,789,123	E146G	probably benign	Het
Fsip2	A	G	2: 82,993,237	D6438G	possibly damaging	Het
Gm3139	T	A	5: 94,537,751	Y423*	probably null	Het
Gm49355	T	A	14: 12,296,672	C10*	probably null	Het
Hfm1	A	G	5: 106,901,703		probably null	Het
Hivep3	T	C	4: 120,132,219	S1956P	probably damaging	Het
Hrh2	A	G	13: 54,221,251	S369G	unknown	Het
Hspg2	T	C	4: 137,533,561		probably null	Het
Hsph1	T	C	5: 149,630,460	Y181C	probably damaging	Het
Kcnh8	A	G	17: 52,894,117		probably null	Het
Kctd1	C	T	18: 15,062,643	E308K	possibly damaging	Het
Kdm8	A	T	7: 125,460,931	Y335F	probably damaging	Het
Kif2b	C	G	11: 91,577,137	G107R	probably benign	Het
Lama4	G	A	10: 38,965,733		probably benign	Het
Lepr	T	C	4: 101,814,764	V995A	probably benign	Het
Mfsd4a	A	T	1: 132,052,393	V375E	probably damaging	Het
Mgl2	G	T	11: 70,137,043	W359L	probably damaging	Het
Muc5b	C	A	7: 141,861,061	Y2581*	probably null	Het
Nol10	G	T	12: 17,373,561		probably null	Het
Olfr1297	T	A	2: 111,621,193	M294L	probably benign	Het
Olfr665	A	T	7: 104,881,141	K145*	probably null	Het
Otud3	C	T	4: 138,909,554	V99M	probably damaging	Het
Parvb	T	C	15: 84,303,471		probably null	Het
Pclo	C	A	5: 14,521,918	P439Q	possibly damaging	Het
Peg10	CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC	CATC	6: 4,756,431		probably benign	Het
Pkn1	A	T	8: 83,692,673	H100Q	possibly damaging	Het
Plce1	A	T	19: 38,760,137	I1771F	probably damaging	Het
Ppp2r3a	T	A	9: 101,126,422	I416L	possibly damaging	Het
Robo1	C	A	16: 72,960,151	C333*	probably null	Het
Ryr2	A	T	13: 11,883,123	Y129N	probably damaging	Het
Schip1	A	T	3: 68,617,699	K359M	probably damaging	Het
Schip1	G	T	3: 68,617,700	K359N	probably damaging	Het
Sh2d2a	T	A	3: 87,848,361	S65T	possibly damaging	Het
Ssrp1	G	A	2: 85,045,562	M588I	probably benign	Het
Stim2	T	A	5: 54,116,128	C567S	probably benign	Het
Syne1	C	A	10: 5,424,295	A171S	probably benign	Het
Tigd3	A	G	19: 5,893,022	S27P	probably benign	Het
Vipr1	C	A	9: 121,664,554	Q224K	probably damaging	Het
Vmn1r75	T	A	7: 11,880,548	M69K	possibly damaging	Het
Vmn2r72	T	G	7: 85,754,917	D22A	probably benign	Het
Zbtb24	G	A	10: 41,464,476	V523I	probably benign	Het
Zbtb43	A	G	2: 33,462,295	F20S	probably benign	Het

Other mutations in Plxna2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00227:Plxna2	APN	1	194644657	missense	probably damaging	1.00
IGL00332:Plxna2	APN	1	194789830	missense	probably damaging	0.98
IGL00392:Plxna2	APN	1	194800568	missense	probably damaging	1.00
IGL00432:Plxna2	APN	1	194644096	missense	probably benign	0.03
IGL00704:Plxna2	APN	1	194751461	missense	probably damaging	0.99
IGL00737:Plxna2	APN	1	194746239	splice site	probably benign
IGL01078:Plxna2	APN	1	194786693	unclassified	probably benign
IGL01354:Plxna2	APN	1	194762435	missense	probably benign	0.02
IGL01432:Plxna2	APN	1	194644318	missense	possibly damaging	0.58
IGL01459:Plxna2	APN	1	194764570	missense	probably benign	0.00
IGL01525:Plxna2	APN	1	194712311	missense	probably benign	0.00
IGL01656:Plxna2	APN	1	194790161	missense	possibly damaging	0.52
IGL01825:Plxna2	APN	1	194788902	missense	probably damaging	0.98
IGL01862:Plxna2	APN	1	194643950	missense	possibly damaging	0.87
IGL01899:Plxna2	APN	1	194751488	missense	probably damaging	1.00
IGL01996:Plxna2	APN	1	194799776	missense	probably damaging	0.99
IGL02123:Plxna2	APN	1	194794383	missense	probably damaging	1.00
IGL02226:Plxna2	APN	1	194644424	missense	probably damaging	1.00
IGL02227:Plxna2	APN	1	194752089	missense	probably damaging	1.00
IGL02415:Plxna2	APN	1	194643964	missense	probably damaging	1.00
IGL02440:Plxna2	APN	1	194746150	missense	probably benign	0.10
IGL02545:Plxna2	APN	1	194786690	unclassified	probably benign
IGL02553:Plxna2	APN	1	194751438	missense	probably benign	0.08
IGL02882:Plxna2	APN	1	194762570	missense	probably damaging	1.00
IGL02946:Plxna2	APN	1	194749309	splice site	probably benign
IGL03062:Plxna2	APN	1	194762550	missense	possibly damaging	0.72
IGL03095:Plxna2	APN	1	194801127	missense	probably damaging	1.00
IGL03293:Plxna2	APN	1	194804945	missense	probably damaging	0.99
G1Funyon:Plxna2	UTSW	1	194790175	missense	probably benign	0.01
PIT4514001:Plxna2	UTSW	1	194794937	missense	probably benign	0.00
R0024:Plxna2	UTSW	1	194643995	missense	possibly damaging	0.57
R0040:Plxna2	UTSW	1	194643896	missense	probably benign	0.13
R0040:Plxna2	UTSW	1	194643896	missense	probably benign	0.13
R0063:Plxna2	UTSW	1	194644939	missense	probably benign	0.00
R0063:Plxna2	UTSW	1	194644939	missense	probably benign	0.00
R0217:Plxna2	UTSW	1	194644598	missense	probably damaging	1.00
R0316:Plxna2	UTSW	1	194644150	missense	probably damaging	1.00
R0440:Plxna2	UTSW	1	194644404	nonsense	probably null
R0505:Plxna2	UTSW	1	194644348	missense	possibly damaging	0.93
R0568:Plxna2	UTSW	1	194751386	missense	probably benign	0.00
R0669:Plxna2	UTSW	1	194788837	missense	probably damaging	0.99
R0674:Plxna2	UTSW	1	194649475	missense	probably benign	0.00
R0885:Plxna2	UTSW	1	194644556	missense	probably benign
R0898:Plxna2	UTSW	1	194797024	missense	probably damaging	1.00
R0940:Plxna2	UTSW	1	194800555	missense	probably benign	0.01
R1061:Plxna2	UTSW	1	194644093	missense	probably damaging	1.00
R1067:Plxna2	UTSW	1	194780510	splice site	probably null
R1222:Plxna2	UTSW	1	194800649	missense	probably damaging	1.00
R1345:Plxna2	UTSW	1	194644486	missense	probably damaging	1.00
R1363:Plxna2	UTSW	1	194804939	nonsense	probably null
R1432:Plxna2	UTSW	1	194767463	missense	probably benign	0.10
R1434:Plxna2	UTSW	1	194751540	splice site	probably benign
R1597:Plxna2	UTSW	1	194749306	splice site	probably benign
R1719:Plxna2	UTSW	1	194644370	missense	possibly damaging	0.93
R1778:Plxna2	UTSW	1	194810970	missense	probably benign	0.01
R1795:Plxna2	UTSW	1	194806303	missense	probably damaging	0.99
R1819:Plxna2	UTSW	1	194790186	missense	probably benign	0.03
R1926:Plxna2	UTSW	1	194762450	missense	probably benign	0.02
R1966:Plxna2	UTSW	1	194644700	missense	possibly damaging	0.91
R1987:Plxna2	UTSW	1	194643989	missense	probably damaging	1.00
R1988:Plxna2	UTSW	1	194643989	missense	probably damaging	1.00
R2034:Plxna2	UTSW	1	194780594	missense	probably benign	0.00
R2131:Plxna2	UTSW	1	194644750	missense	probably benign	0.01
R2171:Plxna2	UTSW	1	194800617	missense	probably damaging	1.00
R2217:Plxna2	UTSW	1	194797748	missense	probably damaging	1.00
R2311:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2340:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2342:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2423:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2424:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2425:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2842:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2971:Plxna2	UTSW	1	194797731	missense	probably damaging	1.00
R3236:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R3731:Plxna2	UTSW	1	194788885	missense	probably benign	0.42
R3783:Plxna2	UTSW	1	194807521	missense	probably damaging	1.00
R3784:Plxna2	UTSW	1	194644617	missense	probably benign
R3787:Plxna2	UTSW	1	194643934	missense	probably benign	0.10
R3845:Plxna2	UTSW	1	194793790	missense	probably damaging	0.96
R3927:Plxna2	UTSW	1	194746157	missense	probably benign	0.02
R3930:Plxna2	UTSW	1	194794910	missense	probably benign	0.17
R3964:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R3980:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4067:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4120:Plxna2	UTSW	1	194780627	missense	probably damaging	1.00
R4231:Plxna2	UTSW	1	194644454	missense	probably damaging	1.00
R4257:Plxna2	UTSW	1	194644775	missense	probably damaging	1.00
R4396:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4397:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4418:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4444:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4446:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4482:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4487:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4489:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4571:Plxna2	UTSW	1	194810988	missense	possibly damaging	0.91
R4622:Plxna2	UTSW	1	194812150	missense	probably benign
R4623:Plxna2	UTSW	1	194812150	missense	probably benign
R4684:Plxna2	UTSW	1	194762594	missense	probably benign	0.42
R4688:Plxna2	UTSW	1	194644445	missense	probably damaging	1.00
R4855:Plxna2	UTSW	1	194797732	missense	probably benign	0.39
R4876:Plxna2	UTSW	1	194643775	missense	probably benign	0.02
R5161:Plxna2	UTSW	1	194751404	missense	probably benign
R5207:Plxna2	UTSW	1	194788899	missense	probably benign	0.19
R5479:Plxna2	UTSW	1	194793873	missense	probably benign
R5931:Plxna2	UTSW	1	194810870	missense	probably damaging	1.00
R6026:Plxna2	UTSW	1	194799814	missense	probably damaging	1.00
R6029:Plxna2	UTSW	1	194794427	missense	probably benign	0.00
R6029:Plxna2	UTSW	1	194799575	missense	probably damaging	1.00
R6059:Plxna2	UTSW	1	194810971	missense	possibly damaging	0.79
R6238:Plxna2	UTSW	1	194790196	missense	probably benign	0.01
R6322:Plxna2	UTSW	1	194754367	missense	possibly damaging	0.89
R6668:Plxna2	UTSW	1	194810088	missense	possibly damaging	0.68
R6709:Plxna2	UTSW	1	194789766	missense	probably benign	0.01
R6748:Plxna2	UTSW	1	194794182	splice site	probably null
R6838:Plxna2	UTSW	1	194804914	missense	possibly damaging	0.90
R6844:Plxna2	UTSW	1	194793828	missense	probably benign	0.08
R7069:Plxna2	UTSW	1	194793904	missense	possibly damaging	0.51
R7122:Plxna2	UTSW	1	194644568	nonsense	probably null
R7145:Plxna2	UTSW	1	194649522	missense	probably benign	0.31
R7207:Plxna2	UTSW	1	194644019	missense	probably damaging	1.00
R7232:Plxna2	UTSW	1	194712260	missense	probably damaging	1.00
R7234:Plxna2	UTSW	1	194806390	missense	probably damaging	0.96
R7246:Plxna2	UTSW	1	194644282	missense	possibly damaging	0.74
R7255:Plxna2	UTSW	1	194752103	missense	probably benign	0.03
R7283:Plxna2	UTSW	1	194644883	missense	probably damaging	0.99
R7288:Plxna2	UTSW	1	194796919	missense	probably damaging	1.00
R7361:Plxna2	UTSW	1	194799779	missense	probably damaging	1.00
R7424:Plxna2	UTSW	1	194806339	missense	probably damaging	0.98
R7501:Plxna2	UTSW	1	194643895	missense	possibly damaging	0.95
R7528:Plxna2	UTSW	1	194812156	missense	probably damaging	1.00
R7529:Plxna2	UTSW	1	194643871	missense	probably benign	0.25
R7532:Plxna2	UTSW	1	194644819	missense	probably benign	0.13
R7959:Plxna2	UTSW	1	194793864	frame shift	probably null
R7959:Plxna2	UTSW	1	194810962	missense	probably damaging	1.00
R7960:Plxna2	UTSW	1	194793864	frame shift	probably null
R8261:Plxna2	UTSW	1	194749416	missense	probably damaging	1.00
R8301:Plxna2	UTSW	1	194790175	missense	probably benign	0.01
R8463:Plxna2	UTSW	1	194644046	missense	probably damaging	1.00
R8519:Plxna2	UTSW	1	194793958	missense	probably damaging	1.00
R8836:Plxna2	UTSW	1	194796935	missense	possibly damaging	0.94
R9010:Plxna2	UTSW	1	194788909	missense	possibly damaging	0.95
R9034:Plxna2	UTSW	1	194793889	missense	probably damaging	1.00
R9254:Plxna2	UTSW	1	194810166	missense	probably damaging	1.00
R9274:Plxna2	UTSW	1	194788828	missense	probably damaging	1.00
R9379:Plxna2	UTSW	1	194810166	missense	probably damaging	1.00
R9385:Plxna2	UTSW	1	194749416	missense	possibly damaging	0.95
R9422:Plxna2	UTSW	1	194644422	missense	probably damaging	1.00
R9451:Plxna2	UTSW	1	194644384	missense	probably benign	0.05
R9484:Plxna2	UTSW	1	194644894	missense	probably damaging	1.00
X0027:Plxna2	UTSW	1	194644433	missense	probably damaging	1.00
Z1088:Plxna2	UTSW	1	194644441	missense	possibly damaging	0.56
Z1088:Plxna2	UTSW	1	194764539	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- CATAGGCTTTGTCCCCTCAG -3'
(R):5'- AGTGCTTGTTCTGAATTTGTCTACC -3'

Sequencing Primer
(F):5'- ATAGGCTTTGTCCCCTCAGATATGAG -3'
(R):5'- ACCTGTGCTTAATCTTACAGAGACC -3'

Posted On

2019-06-26