Mutagenetix > Incidental Mutation

Incidental Mutation 'R7189:Olfr1297'

559476

Institutional Source

Beutler Lab

Gene Symbol

Olfr1297

Ensembl Gene

ENSMUSG00000094858

Gene Name

olfactory receptor 1297

Synonyms

GA_x6K02T2Q125-72673494-72672556, MOR248-4

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.099) question?

Stock #

R7189 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

111615233-111626497 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 111621193 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 294 (M294L)

Ref Sequence

ENSEMBL: ENSMUSP00000150543 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099612] [ENSMUST00000213398]

AlphaFold

Q8VGE8

Predicted Effect

probably benign
Transcript: ENSMUST00000099612
AA Change: M294L

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000097207
Gene: ENSMUSG00000094858
AA Change: M294L

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	304	4.8e-48	PFAM
Pfam:7tm_1	41	287	6.7e-19	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000213398
AA Change: M294L

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

95% (57/60)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abtb2	G	T	2: 103,567,516	A264S	probably benign	Het
Atr	G	T	9: 95,862,791	E54*	probably null	Het
Bmp4	A	G	14: 46,383,999	S363P	probably damaging	Het
Cfap54	C	A	10: 92,937,728	A2077S	unknown	Het
Chrna7	T	C	7: 63,106,027	D257G	probably damaging	Het
Chrnd	C	T	1: 87,191,058	R46W	probably damaging	Het
Cntn2	A	G	1: 132,517,086	I851T	probably damaging	Het
Col3a1	T	A	1: 45,333,657	I534K	unknown	Het
Cyp3a25	A	T	5: 146,003,060	L46I	probably benign	Het
Dnah7b	G	C	1: 46,242,142	G2788R	probably damaging	Het
Dnpep	T	C	1: 75,313,430	E301G	probably damaging	Het
Efcab3	T	C	11: 105,095,864	S30P	probably benign	Het
Elk4	A	G	1: 132,019,389	I373V	probably damaging	Het
Fam161b	T	C	12: 84,348,646	S508G	probably damaging	Het
Fam198b	T	A	3: 79,886,807	L194*	probably null	Het
Fam214a	T	C	9: 75,004,351	C42R	probably damaging	Het
Fam71d	C	T	12: 78,712,208	P101S	probably benign	Het
Fgf10	A	G	13: 118,789,123	E146G	probably benign	Het
Fsip2	A	G	2: 82,993,237	D6438G	possibly damaging	Het
Gm3139	T	A	5: 94,537,751	Y423*	probably null	Het
Gm49355	T	A	14: 12,296,672	C10*	probably null	Het
Hfm1	A	G	5: 106,901,703		probably null	Het
Hivep3	T	C	4: 120,132,219	S1956P	probably damaging	Het
Hrh2	A	G	13: 54,221,251	S369G	unknown	Het
Hspg2	T	C	4: 137,533,561		probably null	Het
Hsph1	T	C	5: 149,630,460	Y181C	probably damaging	Het
Kcnh8	A	G	17: 52,894,117		probably null	Het
Kctd1	C	T	18: 15,062,643	E308K	possibly damaging	Het
Kdm8	A	T	7: 125,460,931	Y335F	probably damaging	Het
Kif2b	C	G	11: 91,577,137	G107R	probably benign	Het
Lama4	G	A	10: 38,965,733		probably benign	Het
Lepr	T	C	4: 101,814,764	V995A	probably benign	Het
Mfsd4a	A	T	1: 132,052,393	V375E	probably damaging	Het
Mgl2	G	T	11: 70,137,043	W359L	probably damaging	Het
Muc5b	C	A	7: 141,861,061	Y2581*	probably null	Het
Nol10	G	T	12: 17,373,561		probably null	Het
Olfr665	A	T	7: 104,881,141	K145*	probably null	Het
Otud3	C	T	4: 138,909,554	V99M	probably damaging	Het
Parvb	T	C	15: 84,303,471		probably null	Het
Pclo	C	A	5: 14,521,918	P439Q	possibly damaging	Het
Peg10	CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC	CATC	6: 4,756,431		probably benign	Het
Pkn1	A	T	8: 83,692,673	H100Q	possibly damaging	Het
Plce1	A	T	19: 38,760,137	I1771F	probably damaging	Het
Plxna2	G	T	1: 194,801,058	R1559L	possibly damaging	Het
Ppp2r3a	T	A	9: 101,126,422	I416L	possibly damaging	Het
Robo1	C	A	16: 72,960,151	C333*	probably null	Het
Ryr2	A	T	13: 11,883,123	Y129N	probably damaging	Het
Schip1	A	T	3: 68,617,699	K359M	probably damaging	Het
Schip1	G	T	3: 68,617,700	K359N	probably damaging	Het
Sh2d2a	T	A	3: 87,848,361	S65T	possibly damaging	Het
Ssrp1	G	A	2: 85,045,562	M588I	probably benign	Het
Stim2	T	A	5: 54,116,128	C567S	probably benign	Het
Syne1	C	A	10: 5,424,295	A171S	probably benign	Het
Tigd3	A	G	19: 5,893,022	S27P	probably benign	Het
Vipr1	C	A	9: 121,664,554	Q224K	probably damaging	Het
Vmn1r75	T	A	7: 11,880,548	M69K	possibly damaging	Het
Vmn2r72	T	G	7: 85,754,917	D22A	probably benign	Het
Zbtb24	G	A	10: 41,464,476	V523I	probably benign	Het
Zbtb43	A	G	2: 33,462,295	F20S	probably benign	Het

Other mutations in Olfr1297

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01068:Olfr1297	APN	2	111621340	missense	probably damaging	1.00
IGL01305:Olfr1297	APN	2	111621201	missense	probably damaging	1.00
IGL01903:Olfr1297	APN	2	111621658	missense	probably benign	0.01
IGL01984:Olfr1297	APN	2	111621582	missense	probably benign	0.34
IGL03065:Olfr1297	APN	2	111621190	missense	probably damaging	0.98
ANU22:Olfr1297	UTSW	2	111621201	missense	probably damaging	1.00
R0313:Olfr1297	UTSW	2	111621600	missense	possibly damaging	0.77
R0615:Olfr1297	UTSW	2	111621919	missense	possibly damaging	0.95
R1028:Olfr1297	UTSW	2	111621525	missense	probably damaging	1.00
R1078:Olfr1297	UTSW	2	111621345	missense	probably damaging	1.00
R1158:Olfr1297	UTSW	2	111621741	missense	probably damaging	1.00
R1419:Olfr1297	UTSW	2	111621295	missense	probably benign	0.05
R1980:Olfr1297	UTSW	2	111621241	missense	probably benign	0.00
R1981:Olfr1297	UTSW	2	111621241	missense	probably benign	0.00
R2044:Olfr1297	UTSW	2	111621814	missense	probably benign	0.02
R2080:Olfr1297	UTSW	2	111621739	missense	probably benign
R2170:Olfr1297	UTSW	2	111621600	missense	possibly damaging	0.77
R4494:Olfr1297	UTSW	2	111621148	nonsense	probably null
R4965:Olfr1297	UTSW	2	111621534	missense	probably damaging	1.00
R5175:Olfr1297	UTSW	2	111621426	missense	possibly damaging	0.78
R5891:Olfr1297	UTSW	2	111621433	missense	probably damaging	1.00
R6192:Olfr1297	UTSW	2	111621175	missense	possibly damaging	0.91
R6383:Olfr1297	UTSW	2	111621186	missense	probably benign	0.10
R6730:Olfr1297	UTSW	2	111621735	missense	probably damaging	0.96
R7193:Olfr1297	UTSW	2	111621255	missense	probably damaging	1.00
R7199:Olfr1297	UTSW	2	111621193	missense	probably benign	0.01
R7735:Olfr1297	UTSW	2	111621474	missense	probably damaging	1.00
R8017:Olfr1297	UTSW	2	111622067	missense	probably benign	0.00
R8019:Olfr1297	UTSW	2	111622067	missense	probably benign	0.00
R8285:Olfr1297	UTSW	2	111622045	missense	probably benign	0.32
R8419:Olfr1297	UTSW	2	111621504	missense	probably benign	0.10
R9258:Olfr1297	UTSW	2	111621984	missense	possibly damaging	0.77
X0063:Olfr1297	UTSW	2	111621381	missense	probably benign	0.04
Z1176:Olfr1297	UTSW	2	111621261	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GATTCACAATGACCTGATAGCTCATC -3'
(R):5'- TGTCCACATGCACTGCACAC -3'

Sequencing Primer
(F):5'- GCTCATCAGTAAATGCCATATTTTC -3'
(R):5'- TGCACACATCACAGTGGTAATG -3'

Posted On

2019-06-26