Mutagenetix > Incidental Mutations

Incidental Mutation 'R0591:Aox4'

55949

Institutional Source

Beutler Lab

Gene Symbol

Aox4

Ensembl Gene

ENSMUSG00000038242

Gene Name

aldehyde oxidase 4

Synonyms

2310003G12Rik, AOH2

MMRRC Submission

038781-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0591 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

58210397-58268597 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 58239102 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000048929 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040442]

AlphaFold

Q3TYQ9

Predicted Effect

probably benign
Transcript: ENSMUST00000040442

SMART Domains

Protein: ENSMUSP00000048929
Gene: ENSMUSG00000038242

Domain	Start	End	E-Value	Type
Pfam:Fer2	12	82	1.6e-10	PFAM
Pfam:Fer2_2	91	165	4.6e-30	PFAM
Pfam:FAD_binding_5	240	421	2.7e-47	PFAM
CO_deh_flav_C	428	532	1.19e-26	SMART
Ald_Xan_dh_C	596	699	8.22e-39	SMART
Pfam:Ald_Xan_dh_C2	709	1243	1.1e-178	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161833

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161926

Coding Region Coverage

1x: 99.7%
3x: 99.2%
10x: 97.7%
20x: 95.3%

Validation Efficiency

100% (62/62)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit a slight decrease in prenatal survival and epidermal thickening that is exacerbated by UV treatment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	G	T	3: 138,068,943	E1298*	probably null	Het
Adam19	T	C	11: 46,121,411		probably benign	Het
Agt	A	T	8: 124,556,939	S480R	possibly damaging	Het
Anapc1	G	T	2: 128,619,332	D1769E	probably benign	Het
Apol9b	G	A	15: 77,735,630	V209I	possibly damaging	Het
Appl2	A	T	10: 83,624,645	I116K	possibly damaging	Het
B230118H07Rik	A	T	2: 101,576,117	D155E	probably benign	Het
BC051665	A	G	13: 60,784,608		probably benign	Het
Cactin	G	T	10: 81,324,003	E89*	probably null	Het
Carf	G	T	1: 60,125,914		probably benign	Het
Ccdc167	A	G	17: 29,705,261		probably benign	Het
Ceacam3	G	A	7: 17,151,883		probably null	Het
Clca4b	T	A	3: 144,915,592	K574*	probably null	Het
Crabp1	T	A	9: 54,765,603	I64N	probably damaging	Het
Dgkd	T	A	1: 87,915,104	I118N	probably damaging	Het
Dglucy	T	C	12: 100,859,518		probably benign	Het
Dock10	C	T	1: 80,541,219		probably benign	Het
Ednrb	A	T	14: 103,823,274		probably null	Het
Ercc6	T	C	14: 32,558,016		probably benign	Het
Gm5538	C	A	3: 59,752,129	Y334*	probably null	Het
Golga3	A	C	5: 110,188,743	Q416P	probably damaging	Het
Gpr12	A	G	5: 146,583,635	V159A	probably benign	Het
Heatr5a	A	T	12: 51,910,101		probably benign	Het
Helz2	A	G	2: 181,232,116	I2195T	probably damaging	Het
Hikeshi	A	T	7: 89,920,087	N76K	possibly damaging	Het
Hsd11b1	T	C	1: 193,229,676		probably benign	Het
Inhba	A	T	13: 16,026,820	K322N	probably damaging	Het
Katnal1	A	T	5: 148,892,516	F291L	probably damaging	Het
Kcnj9	T	C	1: 172,323,098	E316G	probably damaging	Het
Lrsam1	A	G	2: 32,933,923		probably benign	Het
Mcf2l	T	G	8: 13,018,751	S1075A	probably benign	Het
Mios	T	C	6: 8,215,470	V222A	possibly damaging	Het
Mycbp2	A	T	14: 103,196,391		probably benign	Het
Nars	A	T	18: 64,500,567	I544N	probably damaging	Het
Olfr993	A	G	2: 85,414,690	L63P	possibly damaging	Het
Pbrm1	A	G	14: 31,046,430		probably benign	Het
Plcb4	A	G	2: 135,955,012		probably benign	Het
Pnliprp1	A	G	19: 58,734,706	D213G	probably damaging	Het
Psap	A	G	10: 60,300,855	N538D	possibly damaging	Het
Ptdss1	A	G	13: 66,972,650		probably benign	Het
Rap1b	G	A	10: 117,818,617		probably benign	Het
Rhcg	T	A	7: 79,594,772		probably benign	Het
Ryr1	G	A	7: 29,104,795	T550I	possibly damaging	Het
Samm50	G	A	15: 84,211,168	G452R	probably benign	Het
Scin	A	G	12: 40,080,930		probably null	Het
Sesn3	T	C	9: 14,308,558	L81S	probably damaging	Het
Skint6	A	C	4: 112,858,169		probably benign	Het
Slc30a4	A	T	2: 122,685,240	L411H	probably damaging	Het
Slc44a5	C	T	3: 154,234,145		probably benign	Het
Slc4a3	C	T	1: 75,549,021	A255V	probably damaging	Het
Slc9b1	A	G	3: 135,382,832	N318S	possibly damaging	Het
Tcp11l2	A	T	10: 84,604,594	H287L	probably benign	Het
Tex10	C	T	4: 48,456,800	R637Q	probably benign	Het
Tnks2	T	A	19: 36,872,562	Y605N	probably damaging	Het
Topbp1	T	A	9: 103,349,838	N1490K	probably benign	Het
Ube4b	T	G	4: 149,357,577		probably benign	Het
Usp4	G	A	9: 108,348,029		probably benign	Het
Vezf1	A	T	11: 88,068,435		probably benign	Het
Vmn1r184	A	T	7: 26,267,075	D82V	probably damaging	Het

Other mutations in Aox4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00959:Aox4	APN	1	58239174	missense	probably damaging	1.00
IGL01011:Aox4	APN	1	58240775	nonsense	probably null
IGL01634:Aox4	APN	1	58221930	missense	possibly damaging	0.81
IGL01689:Aox4	APN	1	58245161	splice site	probably benign
IGL01874:Aox4	APN	1	58252084	missense	probably damaging	1.00
IGL02104:Aox4	APN	1	58236657	splice site	probably benign
IGL02744:Aox4	APN	1	58255552	missense	possibly damaging	0.90
IGL02751:Aox4	APN	1	58259052	missense	probably damaging	1.00
IGL03225:Aox4	APN	1	58247227	missense	possibly damaging	0.94
IGL03247:Aox4	APN	1	58264367	missense	probably damaging	1.00
IGL03369:Aox4	APN	1	58262587	missense	probably benign	0.01
BB008:Aox4	UTSW	1	58255486	missense	probably benign	0.07
BB018:Aox4	UTSW	1	58255486	missense	probably benign	0.07
R0138:Aox4	UTSW	1	58228866	missense	probably damaging	1.00
R0243:Aox4	UTSW	1	58213076	missense	probably benign
R0368:Aox4	UTSW	1	58213079	missense	probably benign	0.07
R0499:Aox4	UTSW	1	58263397	critical splice donor site	probably null
R0513:Aox4	UTSW	1	58217519	missense	probably benign
R0513:Aox4	UTSW	1	58247300	missense	probably damaging	1.00
R0546:Aox4	UTSW	1	58250174	missense	probably damaging	1.00
R0825:Aox4	UTSW	1	58248909	missense	possibly damaging	0.55
R1912:Aox4	UTSW	1	58264402	missense	probably damaging	1.00
R1934:Aox4	UTSW	1	58245936	missense	probably benign	0.01
R2180:Aox4	UTSW	1	58213067	missense	probably benign	0.00
R2293:Aox4	UTSW	1	58221937	missense	probably damaging	0.99
R3017:Aox4	UTSW	1	58235204	missense	probably benign
R3744:Aox4	UTSW	1	58245870	missense	probably damaging	1.00
R3745:Aox4	UTSW	1	58245870	missense	probably damaging	1.00
R3830:Aox4	UTSW	1	58255511	missense	probably damaging	0.99
R3856:Aox4	UTSW	1	58253934	missense	probably damaging	1.00
R4214:Aox4	UTSW	1	58221892	missense	probably damaging	0.99
R4484:Aox4	UTSW	1	58262571	missense	probably damaging	1.00
R4706:Aox4	UTSW	1	58266787	missense	probably damaging	1.00
R4710:Aox4	UTSW	1	58255638	missense	probably damaging	1.00
R4729:Aox4	UTSW	1	58259077	nonsense	probably null
R4769:Aox4	UTSW	1	58259148	missense	probably null	1.00
R4809:Aox4	UTSW	1	58266649	missense	probably damaging	1.00
R4989:Aox4	UTSW	1	58236676	missense	probably benign	0.00
R5082:Aox4	UTSW	1	58231483	missense	possibly damaging	0.63
R5102:Aox4	UTSW	1	58240778	missense	probably damaging	1.00
R5114:Aox4	UTSW	1	58246286	missense	possibly damaging	0.89
R5133:Aox4	UTSW	1	58236676	missense	probably benign	0.00
R5134:Aox4	UTSW	1	58236676	missense	probably benign	0.00
R5185:Aox4	UTSW	1	58254318	missense	probably damaging	1.00
R5217:Aox4	UTSW	1	58246241	nonsense	probably null
R5426:Aox4	UTSW	1	58220094	missense	probably damaging	1.00
R5443:Aox4	UTSW	1	58233992	splice site	probably null
R5708:Aox4	UTSW	1	58245873	missense	possibly damaging	0.69
R6052:Aox4	UTSW	1	58254318	nonsense	probably null
R6167:Aox4	UTSW	1	58263935	missense	probably damaging	1.00
R6179:Aox4	UTSW	1	58231503	missense	probably benign
R6196:Aox4	UTSW	1	58217526	missense	probably damaging	1.00
R6513:Aox4	UTSW	1	58213053	missense	probably benign	0.01
R6781:Aox4	UTSW	1	58245109	missense	probably benign	0.03
R6885:Aox4	UTSW	1	58264378	missense	probably damaging	1.00
R7082:Aox4	UTSW	1	58224193	missense	possibly damaging	0.82
R7127:Aox4	UTSW	1	58228874	missense	probably benign	0.00
R7153:Aox4	UTSW	1	58250219	missense	probably damaging	0.99
R7371:Aox4	UTSW	1	58263854	missense	probably damaging	1.00
R7690:Aox4	UTSW	1	58263917	missense	probably damaging	1.00
R7745:Aox4	UTSW	1	58240707	missense	probably benign	0.01
R7752:Aox4	UTSW	1	58253948	missense	not run
R7767:Aox4	UTSW	1	58235207	missense	probably damaging	0.98
R7782:Aox4	UTSW	1	58231092	splice site	probably null
R7931:Aox4	UTSW	1	58255486	missense	probably benign	0.07
R7978:Aox4	UTSW	1	58235207	missense	probably damaging	0.98
R7982:Aox4	UTSW	1	58257241	missense	possibly damaging	0.81
R8316:Aox4	UTSW	1	58254311	missense	possibly damaging	0.69
R8361:Aox4	UTSW	1	58240839	missense	probably benign	0.03
R8829:Aox4	UTSW	1	58255490	missense	probably benign	0.01
R8832:Aox4	UTSW	1	58255490	missense	probably benign	0.01
R8896:Aox4	UTSW	1	58252074	missense	probably benign
R9103:Aox4	UTSW	1	58257282	missense	probably damaging	1.00
R9241:Aox4	UTSW	1	58252186	missense	probably damaging	1.00
R9282:Aox4	UTSW	1	58245869	missense	possibly damaging	0.59
X0021:Aox4	UTSW	1	58247295	nonsense	probably null
X0028:Aox4	UTSW	1	58254183	missense	probably damaging	0.99
Z1176:Aox4	UTSW	1	58246351	missense	possibly damaging	0.49

Predicted Primers

PCR Primer
(F):5'- TGTGTCTGTGTGATAAGCCACTTGC -3'
(R):5'- TGTAACTGGGACCTACCTCCCAATG -3'

Sequencing Primer
(F):5'- ctcaagccccaacaccc -3'
(R):5'- TCCCAATGAGCTGCTTGC -3'

Posted On

2013-07-11