Incidental Mutation 'R7189:Syne1'
ID559503
Institutional Source Beutler Lab
Gene Symbol Syne1
Ensembl Gene ENSMUSG00000096054
Gene Namespectrin repeat containing, nuclear envelope 1
SynonymsA330049M09Rik, enaptin165, SYNE-1, nesprin-1, C130039F11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7189 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location5020917-5551482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 5424295 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 171 (A171S)
Ref Sequence ENSEMBL: ENSMUSP00000039440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041639] [ENSMUST00000214945] [ENSMUST00000215295]
Predicted Effect probably benign
Transcript: ENSMUST00000041639
AA Change: A171S

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000039440
Gene: ENSMUSG00000096054
AA Change: A171S

DomainStartEndE-ValueType
CH 29 139 4.55e-14 SMART
low complexity region 145 167 N/A INTRINSIC
CH 187 285 9.67e-18 SMART
coiled coil region 425 452 N/A INTRINSIC
Blast:SPEC 493 599 2e-28 BLAST
Blast:SPEC 606 695 7e-40 BLAST
Blast:SPEC 701 815 1e-32 BLAST
Blast:SPEC 815 913 4e-41 BLAST
Blast:SPEC 920 1013 9e-53 BLAST
Blast:SPEC 1117 1219 2e-60 BLAST
coiled coil region 1267 1329 N/A INTRINSIC
low complexity region 1349 1368 N/A INTRINSIC
coiled coil region 1399 1427 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000214945
AA Change: A164S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000215295
AA Change: A171S

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a spectrin repeat containing protein expressed in skeletal and smooth muscle, and peripheral blood lymphocytes, that localizes to the nuclear membrane. Mutations in this gene have been associated with autosomal recessive spinocerebellar ataxia 8, also referred to as autosomal recessive cerebellar ataxia type 1 or recessive ataxia of Beauce. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an allele lacking the KASH domain exhibit neonatal and postnatal lethality, progressive muscular dystrophy, and limb weakness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 G T 2: 103,567,516 A264S probably benign Het
Atr G T 9: 95,862,791 E54* probably null Het
Bmp4 A G 14: 46,383,999 S363P probably damaging Het
Cfap54 C A 10: 92,937,728 A2077S unknown Het
Chrna7 T C 7: 63,106,027 D257G probably damaging Het
Chrnd C T 1: 87,191,058 R46W probably damaging Het
Cntn2 A G 1: 132,517,086 I851T probably damaging Het
Col3a1 T A 1: 45,333,657 I534K unknown Het
Cyp3a25 A T 5: 146,003,060 L46I probably benign Het
Dnah7b G C 1: 46,242,142 G2788R probably damaging Het
Dnpep T C 1: 75,313,430 E301G probably damaging Het
Efcab3 T C 11: 105,095,864 S30P probably benign Het
Elk4 A G 1: 132,019,389 I373V probably damaging Het
Fam161b T C 12: 84,348,646 S508G probably damaging Het
Fam198b T A 3: 79,886,807 L194* probably null Het
Fam214a T C 9: 75,004,351 C42R probably damaging Het
Fam71d C T 12: 78,712,208 P101S probably benign Het
Fgf10 A G 13: 118,789,123 E146G probably benign Het
Fsip2 A G 2: 82,993,237 D6438G possibly damaging Het
Gm3139 T A 5: 94,537,751 Y423* probably null Het
Gm49355 T A 14: 12,296,672 C10* probably null Het
Hfm1 A G 5: 106,901,703 probably null Het
Hivep3 T C 4: 120,132,219 S1956P probably damaging Het
Hrh2 A G 13: 54,221,251 S369G unknown Het
Hspg2 T C 4: 137,533,561 probably null Het
Hsph1 T C 5: 149,630,460 Y181C probably damaging Het
Kcnh8 A G 17: 52,894,117 probably null Het
Kctd1 C T 18: 15,062,643 E308K possibly damaging Het
Kdm8 A T 7: 125,460,931 Y335F probably damaging Het
Kif2b C G 11: 91,577,137 G107R probably benign Het
Lama4 G A 10: 38,965,733 probably benign Het
Lepr T C 4: 101,814,764 V995A probably benign Het
Mfsd4a A T 1: 132,052,393 V375E probably damaging Het
Mgl2 G T 11: 70,137,043 W359L probably damaging Het
Muc5b C A 7: 141,861,061 Y2581* probably null Het
Nol10 G T 12: 17,373,561 probably null Het
Olfr1297 T A 2: 111,621,193 M294L probably benign Het
Olfr665 A T 7: 104,881,141 K145* probably null Het
Otud3 C T 4: 138,909,554 V99M probably damaging Het
Parvb T C 15: 84,303,471 probably null Het
Pclo C A 5: 14,521,918 P439Q possibly damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Pkn1 A T 8: 83,692,673 H100Q possibly damaging Het
Plce1 A T 19: 38,760,137 I1771F probably damaging Het
Plxna2 G T 1: 194,801,058 R1559L possibly damaging Het
Ppp2r3a T A 9: 101,126,422 I416L possibly damaging Het
Robo1 C A 16: 72,960,151 C333* probably null Het
Ryr2 A T 13: 11,883,123 Y129N probably damaging Het
Schip1 A T 3: 68,617,699 K359M probably damaging Het
Schip1 G T 3: 68,617,700 K359N probably damaging Het
Sh2d2a T A 3: 87,848,361 S65T possibly damaging Het
Ssrp1 G A 2: 85,045,562 M588I probably benign Het
Stim2 T A 5: 54,116,128 C567S probably benign Het
Tigd3 A G 19: 5,893,022 S27P probably benign Het
Vipr1 C A 9: 121,664,554 Q224K probably damaging Het
Vmn1r75 T A 7: 11,880,548 M69K possibly damaging Het
Vmn2r72 T G 7: 85,754,917 D22A probably benign Het
Zbtb24 G A 10: 41,464,476 V523I probably benign Het
Zbtb43 A G 2: 33,462,295 F20S probably benign Het
Other mutations in Syne1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00684:Syne1 APN 10 5342167 synonymous probably benign
IGL00725:Syne1 APN 10 5344922 missense possibly damaging 0.48
IGL00799:Syne1 APN 10 5347878 missense probably benign 0.00
IGL01087:Syne1 APN 10 5425708 missense probably damaging 1.00
IGL01123:Syne1 APN 10 5344921 nonsense probably null
IGL01147:Syne1 APN 10 5052691 nonsense probably null
IGL01150:Syne1 APN 10 5443154 missense probably damaging 1.00
IGL01154:Syne1 APN 10 5360848 missense probably damaging 1.00
IGL01727:Syne1 APN 10 5047842 missense probably damaging 0.99
IGL01761:Syne1 APN 10 5405456 missense probably damaging 1.00
IGL01793:Syne1 APN 10 5352191 missense possibly damaging 0.67
IGL01961:Syne1 APN 10 5043723 missense possibly damaging 0.94
IGL01975:Syne1 APN 10 5068908 intron probably benign
IGL02152:Syne1 APN 10 5424382 missense probably damaging 1.00
IGL02423:Syne1 APN 10 5368295 missense probably benign 0.00
IGL02457:Syne1 APN 10 5342167 missense probably damaging 1.00
IGL02543:Syne1 APN 10 5043618 missense probably damaging 0.97
IGL02836:Syne1 APN 10 5409875 splice site probably benign
IGL03141:Syne1 APN 10 5424261 missense probably damaging 1.00
FR4548:Syne1 UTSW 10 5032969 missense probably benign 0.09
IGL02799:Syne1 UTSW 10 5359059 missense probably damaging 1.00
PIT4305001:Syne1 UTSW 10 5333023 missense probably damaging 1.00
PIT4687001:Syne1 UTSW 10 5358390 missense possibly damaging 0.87
R0004:Syne1 UTSW 10 5443132 splice site probably benign
R0110:Syne1 UTSW 10 5367600 missense probably damaging 1.00
R0165:Syne1 UTSW 10 5033096 missense probably benign 0.28
R0194:Syne1 UTSW 10 5424311 missense probably benign
R0311:Syne1 UTSW 10 5348943 missense possibly damaging 0.92
R0328:Syne1 UTSW 10 5348945 missense possibly damaging 0.62
R0379:Syne1 UTSW 10 5541989 missense probably damaging 1.00
R0387:Syne1 UTSW 10 5351029 missense probably benign
R0452:Syne1 UTSW 10 5405435 missense probably damaging 0.98
R0456:Syne1 UTSW 10 5342252 missense probably benign 0.04
R0457:Syne1 UTSW 10 5022041 missense probably damaging 1.00
R0469:Syne1 UTSW 10 5367600 missense probably damaging 1.00
R0510:Syne1 UTSW 10 5367600 missense probably damaging 1.00
R0533:Syne1 UTSW 10 5358438 missense probably benign 0.00
R0617:Syne1 UTSW 10 5350933 missense probably damaging 1.00
R0690:Syne1 UTSW 10 5033138 splice site probably benign
R0964:Syne1 UTSW 10 5043652 missense possibly damaging 0.95
R1133:Syne1 UTSW 10 5349044 missense possibly damaging 0.77
R1327:Syne1 UTSW 10 5048925 splice site probably benign
R1339:Syne1 UTSW 10 5367571 missense probably damaging 1.00
R1531:Syne1 UTSW 10 5347875 nonsense probably null
R1558:Syne1 UTSW 10 5349280 nonsense probably null
R1633:Syne1 UTSW 10 5349388 missense probably damaging 1.00
R1642:Syne1 UTSW 10 5348694 missense possibly damaging 0.94
R1658:Syne1 UTSW 10 5367616 missense probably benign 0.03
R1753:Syne1 UTSW 10 5367621 missense probably benign 0.28
R1759:Syne1 UTSW 10 5349369 missense probably damaging 1.00
R1792:Syne1 UTSW 10 5040975 missense probably damaging 1.00
R2076:Syne1 UTSW 10 5040897 missense probably damaging 0.99
R2079:Syne1 UTSW 10 5361502 missense probably benign 0.01
R2102:Syne1 UTSW 10 5056514 missense probably damaging 1.00
R2233:Syne1 UTSW 10 5041484 missense probably benign 0.01
R2305:Syne1 UTSW 10 5047573 missense probably damaging 0.97
R3435:Syne1 UTSW 10 5348565 missense probably damaging 1.00
R3749:Syne1 UTSW 10 5052267 splice site probably benign
R3876:Syne1 UTSW 10 5052345 missense possibly damaging 0.57
R3895:Syne1 UTSW 10 5405456 missense probably damaging 0.98
R3974:Syne1 UTSW 10 5043630 missense probably benign 0.06
R4042:Syne1 UTSW 10 5041584 missense probably benign 0.21
R4120:Syne1 UTSW 10 5409798 missense probably damaging 1.00
R4201:Syne1 UTSW 10 5347870 missense probably benign
R4364:Syne1 UTSW 10 5353987 missense probably damaging 0.96
R4498:Syne1 UTSW 10 5031768 missense probably benign 0.00
R4767:Syne1 UTSW 10 5344866 nonsense probably null
R4804:Syne1 UTSW 10 5349310 missense possibly damaging 0.95
R4917:Syne1 UTSW 10 5057909 missense probably damaging 1.00
R4930:Syne1 UTSW 10 5052777 missense probably damaging 0.99
R5081:Syne1 UTSW 10 5047767 missense probably benign 0.04
R5089:Syne1 UTSW 10 5405444 nonsense probably null
R5174:Syne1 UTSW 10 5041490 missense probably damaging 0.99
R5205:Syne1 UTSW 10 5052295 missense probably benign 0.05
R5303:Syne1 UTSW 10 5420464 missense probably benign 0.00
R5384:Syne1 UTSW 10 5041494 missense probably benign 0.00
R5385:Syne1 UTSW 10 5041494 missense probably benign 0.00
R5392:Syne1 UTSW 10 5348661 missense probably damaging 1.00
R5442:Syne1 UTSW 10 5343473 missense probably benign 0.09
R5750:Syne1 UTSW 10 5339209 missense probably benign 0.01
R5935:Syne1 UTSW 10 5360706 unclassified probably null
R6015:Syne1 UTSW 10 5346819 critical splice donor site probably null
R6023:Syne1 UTSW 10 5443223 missense probably benign 0.09
R6049:Syne1 UTSW 10 5347926 missense possibly damaging 0.79
R6084:Syne1 UTSW 10 5348994 missense probably damaging 1.00
R6145:Syne1 UTSW 10 5052750 missense probably damaging 1.00
R6164:Syne1 UTSW 10 5061429 missense probably damaging 1.00
R6165:Syne1 UTSW 10 5425678 missense probably damaging 1.00
R6198:Syne1 UTSW 10 5302269 missense probably damaging 0.99
R6217:Syne1 UTSW 10 5293761 missense probably benign 0.00
R6247:Syne1 UTSW 10 5349071 missense probably damaging 0.98
R6271:Syne1 UTSW 10 5234652 missense probably damaging 1.00
R6338:Syne1 UTSW 10 5255475 missense probably benign 0.00
R6344:Syne1 UTSW 10 5022212 missense probably benign 0.08
R6434:Syne1 UTSW 10 5318422 missense probably benign 0.01
R6476:Syne1 UTSW 10 5154531 missense possibly damaging 0.88
R6479:Syne1 UTSW 10 5231679 nonsense probably null
R6479:Syne1 UTSW 10 5456826 missense probably damaging 1.00
R6546:Syne1 UTSW 10 5218645 nonsense probably null
R6578:Syne1 UTSW 10 5405454 nonsense probably null
R6611:Syne1 UTSW 10 5045273 missense probably benign 0.01
R6615:Syne1 UTSW 10 5301340 missense probably damaging 0.98
R6632:Syne1 UTSW 10 5215667 critical splice donor site probably null
R6662:Syne1 UTSW 10 5128416 missense probably damaging 1.00
R6677:Syne1 UTSW 10 5040942 missense possibly damaging 0.82
R6764:Syne1 UTSW 10 5229011 nonsense probably null
R6765:Syne1 UTSW 10 5143285 intron probably null
R6778:Syne1 UTSW 10 5102406 missense probably damaging 0.97
R6851:Syne1 UTSW 10 5262703 nonsense probably null
R6878:Syne1 UTSW 10 5420388 missense possibly damaging 0.78
R6883:Syne1 UTSW 10 5231704 nonsense probably null
R6910:Syne1 UTSW 10 5048887 missense probably benign 0.01
R6916:Syne1 UTSW 10 5227912 missense probably benign 0.00
R6925:Syne1 UTSW 10 5126682 missense probably benign 0.00
R6943:Syne1 UTSW 10 5083940 missense probably benign
R6947:Syne1 UTSW 10 5175789 missense probably damaging 1.00
R6965:Syne1 UTSW 10 5229120 missense possibly damaging 0.66
R6968:Syne1 UTSW 10 5117041 missense probably benign 0.09
R7043:Syne1 UTSW 10 5072193 missense possibly damaging 0.77
R7059:Syne1 UTSW 10 5346859 missense probably damaging 1.00
R7067:Syne1 UTSW 10 5234586 missense probably damaging 1.00
R7087:Syne1 UTSW 10 5542024 start gained probably benign
R7099:Syne1 UTSW 10 5123744 missense probably benign 0.43
R7107:Syne1 UTSW 10 5132078 missense probably damaging 1.00
R7120:Syne1 UTSW 10 5293971 missense probably benign
R7127:Syne1 UTSW 10 5243180 missense probably damaging 1.00
R7128:Syne1 UTSW 10 5243180 missense probably damaging 1.00
R7131:Syne1 UTSW 10 5228221 missense probably damaging 1.00
R7132:Syne1 UTSW 10 5243180 missense probably damaging 1.00
R7133:Syne1 UTSW 10 5231592 missense probably damaging 1.00
R7135:Syne1 UTSW 10 5233409 missense probably benign 0.01
R7147:Syne1 UTSW 10 5249340 missense probably damaging 1.00
R7158:Syne1 UTSW 10 5057931 missense probably damaging 1.00
R7193:Syne1 UTSW 10 5233406 missense probably damaging 1.00
R7194:Syne1 UTSW 10 5110859 missense probably damaging 1.00
R7233:Syne1 UTSW 10 5302160 missense probably damaging 1.00
R7255:Syne1 UTSW 10 5333446 missense probably damaging 0.98
R7267:Syne1 UTSW 10 5228218 missense probably damaging 1.00
R7294:Syne1 UTSW 10 5097483 critical splice donor site probably null
R7303:Syne1 UTSW 10 5256805 missense probably benign 0.04
R7313:Syne1 UTSW 10 5047635 missense probably damaging 1.00
R7330:Syne1 UTSW 10 5128434 missense probably benign 0.00
R7334:Syne1 UTSW 10 5057886 missense probably damaging 1.00
R7363:Syne1 UTSW 10 5140970 missense possibly damaging 0.45
R7400:Syne1 UTSW 10 5218580 missense probably benign 0.12
R7425:Syne1 UTSW 10 5425760 missense probably damaging 1.00
R7427:Syne1 UTSW 10 5273718 missense probably damaging 0.98
R7446:Syne1 UTSW 10 5222266 missense probably benign 0.00
R7462:Syne1 UTSW 10 5052793 missense possibly damaging 0.87
R7502:Syne1 UTSW 10 5333446 missense probably damaging 0.98
R7525:Syne1 UTSW 10 5185559 critical splice acceptor site probably null
R7529:Syne1 UTSW 10 5424382 missense probably damaging 1.00
R7577:Syne1 UTSW 10 5124820 missense probably damaging 1.00
R7579:Syne1 UTSW 10 5349324 missense probably damaging 1.00
R7594:Syne1 UTSW 10 5215190 critical splice donor site probably null
R7646:Syne1 UTSW 10 5172949 missense probably damaging 1.00
R7651:Syne1 UTSW 10 5205074 missense probably benign 0.38
R7651:Syne1 UTSW 10 5343416 missense probably damaging 1.00
R7669:Syne1 UTSW 10 5061531 missense probably damaging 1.00
R7672:Syne1 UTSW 10 5218527 missense probably benign 0.02
R7682:Syne1 UTSW 10 5162461 missense probably benign
R7702:Syne1 UTSW 10 5245835 missense probably damaging 1.00
X0017:Syne1 UTSW 10 5346917 missense probably damaging 1.00
X0025:Syne1 UTSW 10 5358973 nonsense probably null
X0063:Syne1 UTSW 10 5052354 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCACAACCACGGGAAGC -3'
(R):5'- TGTAAGATATACCCAGCAAGGC -3'

Sequencing Primer
(F):5'- CAGTGAGACCGTTACATTGGC -3'
(R):5'- CTCTAGAAGACCAGGGTTCAGTTC -3'
Posted On2019-06-26