Mutagenetix > Incidental Mutations

Incidental Mutation 'R7189:Syne1'

559503

Institutional Source

Beutler Lab

Gene Symbol

Syne1

Ensembl Gene

ENSMUSG00000096054

Gene Name

spectrin repeat containing, nuclear envelope 1

Synonyms

A330049M09Rik, enaptin165, SYNE-1, nesprin-1, C130039F11Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7189 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

5020917-5551482 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 5424295 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 171 (A171S)

Ref Sequence

ENSEMBL: ENSMUSP00000039440 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041639] [ENSMUST00000214945] [ENSMUST00000215295]

Predicted Effect

probably benign
Transcript: ENSMUST00000041639
AA Change: A171S

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000039440
Gene: ENSMUSG00000096054
AA Change: A171S

Domain	Start	End	E-Value	Type
CH	29	139	4.55e-14	SMART
low complexity region	145	167	N/A	INTRINSIC
CH	187	285	9.67e-18	SMART
coiled coil region	425	452	N/A	INTRINSIC
Blast:SPEC	493	599	2e-28	BLAST
Blast:SPEC	606	695	7e-40	BLAST
Blast:SPEC	701	815	1e-32	BLAST
Blast:SPEC	815	913	4e-41	BLAST
Blast:SPEC	920	1013	9e-53	BLAST
Blast:SPEC	1117	1219	2e-60	BLAST
coiled coil region	1267	1329	N/A	INTRINSIC
low complexity region	1349	1368	N/A	INTRINSIC
coiled coil region	1399	1427	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000214945
AA Change: A164S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

Predicted Effect

probably benign
Transcript: ENSMUST00000215295
AA Change: A171S

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

95% (57/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a spectrin repeat containing protein expressed in skeletal and smooth muscle, and peripheral blood lymphocytes, that localizes to the nuclear membrane. Mutations in this gene have been associated with autosomal recessive spinocerebellar ataxia 8, also referred to as autosomal recessive cerebellar ataxia type 1 or recessive ataxia of Beauce. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an allele lacking the KASH domain exhibit neonatal and postnatal lethality, progressive muscular dystrophy, and limb weakness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abtb2	G	T	2: 103,567,516	A264S	probably benign	Het
Atr	G	T	9: 95,862,791	E54*	probably null	Het
Bmp4	A	G	14: 46,383,999	S363P	probably damaging	Het
Cfap54	C	A	10: 92,937,728	A2077S	unknown	Het
Chrna7	T	C	7: 63,106,027	D257G	probably damaging	Het
Chrnd	C	T	1: 87,191,058	R46W	probably damaging	Het
Cntn2	A	G	1: 132,517,086	I851T	probably damaging	Het
Col3a1	T	A	1: 45,333,657	I534K	unknown	Het
Cyp3a25	A	T	5: 146,003,060	L46I	probably benign	Het
Dnah7b	G	C	1: 46,242,142	G2788R	probably damaging	Het
Dnpep	T	C	1: 75,313,430	E301G	probably damaging	Het
Efcab3	T	C	11: 105,095,864	S30P	probably benign	Het
Elk4	A	G	1: 132,019,389	I373V	probably damaging	Het
Fam161b	T	C	12: 84,348,646	S508G	probably damaging	Het
Fam198b	T	A	3: 79,886,807	L194*	probably null	Het
Fam214a	T	C	9: 75,004,351	C42R	probably damaging	Het
Fam71d	C	T	12: 78,712,208	P101S	probably benign	Het
Fgf10	A	G	13: 118,789,123	E146G	probably benign	Het
Fsip2	A	G	2: 82,993,237	D6438G	possibly damaging	Het
Gm3139	T	A	5: 94,537,751	Y423*	probably null	Het
Gm49355	T	A	14: 12,296,672	C10*	probably null	Het
Hfm1	A	G	5: 106,901,703		probably null	Het
Hivep3	T	C	4: 120,132,219	S1956P	probably damaging	Het
Hrh2	A	G	13: 54,221,251	S369G	unknown	Het
Hspg2	T	C	4: 137,533,561		probably null	Het
Hsph1	T	C	5: 149,630,460	Y181C	probably damaging	Het
Kcnh8	A	G	17: 52,894,117		probably null	Het
Kctd1	C	T	18: 15,062,643	E308K	possibly damaging	Het
Kdm8	A	T	7: 125,460,931	Y335F	probably damaging	Het
Kif2b	C	G	11: 91,577,137	G107R	probably benign	Het
Lama4	G	A	10: 38,965,733		probably benign	Het
Lepr	T	C	4: 101,814,764	V995A	probably benign	Het
Mfsd4a	A	T	1: 132,052,393	V375E	probably damaging	Het
Mgl2	G	T	11: 70,137,043	W359L	probably damaging	Het
Muc5b	C	A	7: 141,861,061	Y2581*	probably null	Het
Nol10	G	T	12: 17,373,561		probably null	Het
Olfr1297	T	A	2: 111,621,193	M294L	probably benign	Het
Olfr665	A	T	7: 104,881,141	K145*	probably null	Het
Otud3	C	T	4: 138,909,554	V99M	probably damaging	Het
Parvb	T	C	15: 84,303,471		probably null	Het
Pclo	C	A	5: 14,521,918	P439Q	possibly damaging	Het
Peg10	CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC	CATC	6: 4,756,431		probably benign	Het
Pkn1	A	T	8: 83,692,673	H100Q	possibly damaging	Het
Plce1	A	T	19: 38,760,137	I1771F	probably damaging	Het
Plxna2	G	T	1: 194,801,058	R1559L	possibly damaging	Het
Ppp2r3a	T	A	9: 101,126,422	I416L	possibly damaging	Het
Robo1	C	A	16: 72,960,151	C333*	probably null	Het
Ryr2	A	T	13: 11,883,123	Y129N	probably damaging	Het
Schip1	A	T	3: 68,617,699	K359M	probably damaging	Het
Schip1	G	T	3: 68,617,700	K359N	probably damaging	Het
Sh2d2a	T	A	3: 87,848,361	S65T	possibly damaging	Het
Ssrp1	G	A	2: 85,045,562	M588I	probably benign	Het
Stim2	T	A	5: 54,116,128	C567S	probably benign	Het
Tigd3	A	G	19: 5,893,022	S27P	probably benign	Het
Vipr1	C	A	9: 121,664,554	Q224K	probably damaging	Het
Vmn1r75	T	A	7: 11,880,548	M69K	possibly damaging	Het
Vmn2r72	T	G	7: 85,754,917	D22A	probably benign	Het
Zbtb24	G	A	10: 41,464,476	V523I	probably benign	Het
Zbtb43	A	G	2: 33,462,295	F20S	probably benign	Het

Other mutations in Syne1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00684:Syne1	APN	10	5342167	synonymous	probably benign
IGL00725:Syne1	APN	10	5344922	missense	possibly damaging	0.48
IGL00799:Syne1	APN	10	5347878	missense	probably benign	0.00
IGL01087:Syne1	APN	10	5425708	missense	probably damaging	1.00
IGL01123:Syne1	APN	10	5344921	nonsense	probably null
IGL01147:Syne1	APN	10	5052691	nonsense	probably null
IGL01150:Syne1	APN	10	5443154	missense	probably damaging	1.00
IGL01154:Syne1	APN	10	5360848	missense	probably damaging	1.00
IGL01727:Syne1	APN	10	5047842	missense	probably damaging	0.99
IGL01761:Syne1	APN	10	5405456	missense	probably damaging	1.00
IGL01793:Syne1	APN	10	5352191	missense	possibly damaging	0.67
IGL01961:Syne1	APN	10	5043723	missense	possibly damaging	0.94
IGL01975:Syne1	APN	10	5068908	intron	probably benign
IGL02152:Syne1	APN	10	5424382	missense	probably damaging	1.00
IGL02423:Syne1	APN	10	5368295	missense	probably benign	0.00
IGL02457:Syne1	APN	10	5342167	missense	probably damaging	1.00
IGL02543:Syne1	APN	10	5043618	missense	probably damaging	0.97
IGL02836:Syne1	APN	10	5409875	splice site	probably benign
IGL03141:Syne1	APN	10	5424261	missense	probably damaging	1.00
FR4548:Syne1	UTSW	10	5032969	missense	probably benign	0.09
IGL02799:Syne1	UTSW	10	5359059	missense	probably damaging	1.00
PIT4305001:Syne1	UTSW	10	5333023	missense	probably damaging	1.00
PIT4687001:Syne1	UTSW	10	5358390	missense	possibly damaging	0.87
R0004:Syne1	UTSW	10	5443132	splice site	probably benign
R0110:Syne1	UTSW	10	5367600	missense	probably damaging	1.00
R0165:Syne1	UTSW	10	5033096	missense	probably benign	0.28
R0194:Syne1	UTSW	10	5424311	missense	probably benign
R0311:Syne1	UTSW	10	5348943	missense	possibly damaging	0.92
R0328:Syne1	UTSW	10	5348945	missense	possibly damaging	0.62
R0379:Syne1	UTSW	10	5541989	missense	probably damaging	1.00
R0387:Syne1	UTSW	10	5351029	missense	probably benign
R0452:Syne1	UTSW	10	5405435	missense	probably damaging	0.98
R0456:Syne1	UTSW	10	5342252	missense	probably benign	0.04
R0457:Syne1	UTSW	10	5022041	missense	probably damaging	1.00
R0469:Syne1	UTSW	10	5367600	missense	probably damaging	1.00
R0510:Syne1	UTSW	10	5367600	missense	probably damaging	1.00
R0533:Syne1	UTSW	10	5358438	missense	probably benign	0.00
R0617:Syne1	UTSW	10	5350933	missense	probably damaging	1.00
R0690:Syne1	UTSW	10	5033138	splice site	probably benign
R0964:Syne1	UTSW	10	5043652	missense	possibly damaging	0.95
R1133:Syne1	UTSW	10	5349044	missense	possibly damaging	0.77
R1327:Syne1	UTSW	10	5048925	splice site	probably benign
R1339:Syne1	UTSW	10	5367571	missense	probably damaging	1.00
R1531:Syne1	UTSW	10	5347875	nonsense	probably null
R1558:Syne1	UTSW	10	5349280	nonsense	probably null
R1633:Syne1	UTSW	10	5349388	missense	probably damaging	1.00
R1642:Syne1	UTSW	10	5348694	missense	possibly damaging	0.94
R1658:Syne1	UTSW	10	5367616	missense	probably benign	0.03
R1753:Syne1	UTSW	10	5367621	missense	probably benign	0.28
R1759:Syne1	UTSW	10	5349369	missense	probably damaging	1.00
R1792:Syne1	UTSW	10	5040975	missense	probably damaging	1.00
R2076:Syne1	UTSW	10	5040897	missense	probably damaging	0.99
R2079:Syne1	UTSW	10	5361502	missense	probably benign	0.01
R2102:Syne1	UTSW	10	5056514	missense	probably damaging	1.00
R2233:Syne1	UTSW	10	5041484	missense	probably benign	0.01
R2305:Syne1	UTSW	10	5047573	missense	probably damaging	0.97
R3435:Syne1	UTSW	10	5348565	missense	probably damaging	1.00
R3749:Syne1	UTSW	10	5052267	splice site	probably benign
R3876:Syne1	UTSW	10	5052345	missense	possibly damaging	0.57
R3895:Syne1	UTSW	10	5405456	missense	probably damaging	0.98
R3974:Syne1	UTSW	10	5043630	missense	probably benign	0.06
R4042:Syne1	UTSW	10	5041584	missense	probably benign	0.21
R4120:Syne1	UTSW	10	5409798	missense	probably damaging	1.00
R4201:Syne1	UTSW	10	5347870	missense	probably benign
R4364:Syne1	UTSW	10	5353987	missense	probably damaging	0.96
R4498:Syne1	UTSW	10	5031768	missense	probably benign	0.00
R4767:Syne1	UTSW	10	5344866	nonsense	probably null
R4804:Syne1	UTSW	10	5349310	missense	possibly damaging	0.95
R4917:Syne1	UTSW	10	5057909	missense	probably damaging	1.00
R4930:Syne1	UTSW	10	5052777	missense	probably damaging	0.99
R5081:Syne1	UTSW	10	5047767	missense	probably benign	0.04
R5089:Syne1	UTSW	10	5405444	nonsense	probably null
R5174:Syne1	UTSW	10	5041490	missense	probably damaging	0.99
R5205:Syne1	UTSW	10	5052295	missense	probably benign	0.05
R5303:Syne1	UTSW	10	5420464	missense	probably benign	0.00
R5384:Syne1	UTSW	10	5041494	missense	probably benign	0.00
R5385:Syne1	UTSW	10	5041494	missense	probably benign	0.00
R5392:Syne1	UTSW	10	5348661	missense	probably damaging	1.00
R5442:Syne1	UTSW	10	5343473	missense	probably benign	0.09
R5750:Syne1	UTSW	10	5339209	missense	probably benign	0.01
R5935:Syne1	UTSW	10	5360706	splice site	probably null
R6015:Syne1	UTSW	10	5346819	critical splice donor site	probably null
R6023:Syne1	UTSW	10	5443223	missense	probably benign	0.09
R6049:Syne1	UTSW	10	5347926	missense	possibly damaging	0.79
R6084:Syne1	UTSW	10	5348994	missense	probably damaging	1.00
R6145:Syne1	UTSW	10	5052750	missense	probably damaging	1.00
R6164:Syne1	UTSW	10	5061429	missense	probably damaging	1.00
R6165:Syne1	UTSW	10	5425678	missense	probably damaging	1.00
R6198:Syne1	UTSW	10	5302269	missense	probably damaging	0.99
R6217:Syne1	UTSW	10	5293761	missense	probably benign	0.00
R6247:Syne1	UTSW	10	5349071	missense	probably damaging	0.98
R6271:Syne1	UTSW	10	5234652	missense	probably damaging	1.00
R6338:Syne1	UTSW	10	5255475	missense	probably benign	0.00
R6344:Syne1	UTSW	10	5022212	missense	probably benign	0.08
R6434:Syne1	UTSW	10	5318422	missense	probably benign	0.01
R6476:Syne1	UTSW	10	5154531	missense	possibly damaging	0.88
R6479:Syne1	UTSW	10	5231679	nonsense	probably null
R6479:Syne1	UTSW	10	5456826	missense	probably damaging	1.00
R6546:Syne1	UTSW	10	5218645	nonsense	probably null
R6578:Syne1	UTSW	10	5405454	nonsense	probably null
R6611:Syne1	UTSW	10	5045273	missense	probably benign	0.01
R6615:Syne1	UTSW	10	5301340	missense	probably damaging	0.98
R6632:Syne1	UTSW	10	5215667	critical splice donor site	probably null
R6662:Syne1	UTSW	10	5128416	missense	probably damaging	1.00
R6677:Syne1	UTSW	10	5040942	missense	possibly damaging	0.82
R6764:Syne1	UTSW	10	5229011	nonsense	probably null
R6765:Syne1	UTSW	10	5143285	splice site	probably null
R6778:Syne1	UTSW	10	5102406	missense	probably damaging	0.97
R6851:Syne1	UTSW	10	5262703	nonsense	probably null
R6878:Syne1	UTSW	10	5420388	missense	possibly damaging	0.78
R6883:Syne1	UTSW	10	5231704	nonsense	probably null
R6910:Syne1	UTSW	10	5048887	missense	probably benign	0.01
R6916:Syne1	UTSW	10	5227912	missense	probably benign	0.00
R6925:Syne1	UTSW	10	5126682	missense	probably benign	0.00
R6943:Syne1	UTSW	10	5083940	missense	probably benign
R6947:Syne1	UTSW	10	5175789	missense	probably damaging	1.00
R6965:Syne1	UTSW	10	5229120	missense	possibly damaging	0.66
R6968:Syne1	UTSW	10	5117041	missense	probably benign	0.09
R7043:Syne1	UTSW	10	5072193	missense	possibly damaging	0.77
R7059:Syne1	UTSW	10	5346859	missense	probably damaging	1.00
R7067:Syne1	UTSW	10	5234586	missense	probably damaging	1.00
R7087:Syne1	UTSW	10	5542024	start gained	probably benign
R7099:Syne1	UTSW	10	5123744	missense	probably benign	0.43
R7107:Syne1	UTSW	10	5132078	missense	probably damaging	1.00
R7120:Syne1	UTSW	10	5293971	missense	probably benign
R7127:Syne1	UTSW	10	5243180	missense	probably damaging	1.00
R7128:Syne1	UTSW	10	5243180	missense	probably damaging	1.00
R7131:Syne1	UTSW	10	5228221	missense	probably damaging	1.00
R7132:Syne1	UTSW	10	5243180	missense	probably damaging	1.00
R7133:Syne1	UTSW	10	5231592	missense	probably damaging	1.00
R7135:Syne1	UTSW	10	5233409	missense	probably benign	0.01
R7147:Syne1	UTSW	10	5249340	missense	probably damaging	1.00
R7158:Syne1	UTSW	10	5057931	missense	probably damaging	1.00
R7193:Syne1	UTSW	10	5233406	missense	probably damaging	1.00
R7194:Syne1	UTSW	10	5110859	missense	probably damaging	1.00
R7233:Syne1	UTSW	10	5302160	missense	probably damaging	1.00
R7255:Syne1	UTSW	10	5333446	missense	probably damaging	0.98
R7267:Syne1	UTSW	10	5228218	missense	probably damaging	1.00
R7294:Syne1	UTSW	10	5097483	critical splice donor site	probably null
R7303:Syne1	UTSW	10	5256805	missense	probably benign	0.04
R7313:Syne1	UTSW	10	5047635	missense	probably damaging	1.00
R7330:Syne1	UTSW	10	5128434	missense	probably benign	0.00
R7334:Syne1	UTSW	10	5057886	missense	probably damaging	1.00
R7363:Syne1	UTSW	10	5140970	missense	possibly damaging	0.45
R7400:Syne1	UTSW	10	5218580	missense	probably benign	0.12
R7425:Syne1	UTSW	10	5425760	missense	probably damaging	1.00
R7427:Syne1	UTSW	10	5273718	missense	probably damaging	0.98
R7446:Syne1	UTSW	10	5222266	missense	probably benign	0.00
R7462:Syne1	UTSW	10	5052793	missense	possibly damaging	0.87
R7502:Syne1	UTSW	10	5333446	missense	probably damaging	0.98
R7525:Syne1	UTSW	10	5185559	critical splice acceptor site	probably null
R7529:Syne1	UTSW	10	5424382	missense	probably damaging	1.00
R7577:Syne1	UTSW	10	5124820	missense	probably damaging	1.00
R7579:Syne1	UTSW	10	5349324	missense	probably damaging	1.00
R7594:Syne1	UTSW	10	5215190	critical splice donor site	probably null
R7646:Syne1	UTSW	10	5172949	missense	probably damaging	1.00
R7651:Syne1	UTSW	10	5205074	missense	probably benign	0.38
R7651:Syne1	UTSW	10	5343416	missense	probably damaging	1.00
R7669:Syne1	UTSW	10	5061531	missense	probably damaging	1.00
R7672:Syne1	UTSW	10	5218527	missense	probably benign	0.02
R7682:Syne1	UTSW	10	5162461	missense	probably benign
R7702:Syne1	UTSW	10	5245835	missense	probably damaging	1.00
R7767:Syne1	UTSW	10	5333560	missense	possibly damaging	0.60
R7767:Syne1	UTSW	10	5333632	missense	possibly damaging	0.49
R7829:Syne1	UTSW	10	5342293	missense	probably damaging	0.96
R7840:Syne1	UTSW	10	5132078	missense	probably damaging	1.00
R7859:Syne1	UTSW	10	5157683	missense	possibly damaging	0.80
R7899:Syne1	UTSW	10	5227956	nonsense	probably null
R7918:Syne1	UTSW	10	5359078	missense	possibly damaging	0.50
R7923:Syne1	UTSW	10	5264738	missense	probably damaging	1.00
R7946:Syne1	UTSW	10	5250919	missense	possibly damaging	0.92
R7966:Syne1	UTSW	10	5116965	critical splice donor site	probably null
R7975:Syne1	UTSW	10	5031786	missense	probably benign	0.00
R7981:Syne1	UTSW	10	5229248	missense	probably benign	0.04
R8053:Syne1	UTSW	10	5052658	nonsense	probably null
R8054:Syne1	UTSW	10	5270970	missense	probably benign	0.22
R8062:Syne1	UTSW	10	5185394	critical splice donor site	probably null
R8085:Syne1	UTSW	10	5228021	missense	possibly damaging	0.78
R8087:Syne1	UTSW	10	5333034	missense	probably benign
R8094:Syne1	UTSW	10	5117031	missense	probably damaging	0.98
R8310:Syne1	UTSW	10	5347829	missense	probably benign
R8325:Syne1	UTSW	10	5146257	missense	probably benign	0.15
R8342:Syne1	UTSW	10	5108622	missense	probably benign	0.18
R8353:Syne1	UTSW	10	5350983	missense	probably damaging	1.00
R8376:Syne1	UTSW	10	5043615	missense	probably benign	0.09
R8398:Syne1	UTSW	10	5124923	missense	probably damaging	1.00
R8434:Syne1	UTSW	10	5123057	missense	probably benign	0.00
R8436:Syne1	UTSW	10	5228659	missense	probably benign	0.26
R8459:Syne1	UTSW	10	5424277	nonsense	probably null
R8461:Syne1	UTSW	10	5061463	missense	probably benign	0.34
R8496:Syne1	UTSW	10	5228896	missense	probably damaging	0.99
R8496:Syne1	UTSW	10	5318441	missense	probably damaging	0.99
RF010:Syne1	UTSW	10	5246386	missense	possibly damaging	0.89
RF015:Syne1	UTSW	10	5302248	missense	probably benign	0.01
RF023:Syne1	UTSW	10	5255482	missense	probably damaging	1.00
X0017:Syne1	UTSW	10	5346917	missense	probably damaging	1.00
X0025:Syne1	UTSW	10	5358973	nonsense	probably null
X0063:Syne1	UTSW	10	5052354	missense	probably damaging	1.00
Z1176:Syne1	UTSW	10	5248364	missense	probably damaging	0.96
Z1176:Syne1	UTSW	10	5259280	missense	probably benign
Z1176:Syne1	UTSW	10	5330251	missense	probably benign	0.10
Z1177:Syne1	UTSW	10	5143230	missense	possibly damaging	0.78
Z1177:Syne1	UTSW	10	5259349	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTCACAACCACGGGAAGC -3'
(R):5'- TGTAAGATATACCCAGCAAGGC -3'

Sequencing Primer
(F):5'- CAGTGAGACCGTTACATTGGC -3'
(R):5'- CTCTAGAAGACCAGGGTTCAGTTC -3'

Posted On

2019-06-26