Incidental Mutation 'R7189:Zbtb24'
ID 559504
Institutional Source Beutler Lab
Gene Symbol Zbtb24
Ensembl Gene ENSMUSG00000019826
Gene Name zinc finger and BTB domain containing 24
Synonyms ZNF450
MMRRC Submission 045238-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7189 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 41326379-41341570 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 41340472 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 523 (V523I)
Ref Sequence ENSEMBL: ENSMUSP00000079592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080771] [ENSMUST00000213797]
AlphaFold Q80X44
Predicted Effect probably benign
Transcript: ENSMUST00000080771
AA Change: V523I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000079592
Gene: ENSMUSG00000019826
AA Change: V523I

DomainStartEndE-ValueType
BTB 37 133 5.81e-26 SMART
AT_hook 159 171 2.23e-1 SMART
low complexity region 248 260 N/A INTRINSIC
ZnF_C2H2 293 315 8.67e-1 SMART
ZnF_C2H2 321 343 4.87e-4 SMART
ZnF_C2H2 349 371 6.42e-4 SMART
ZnF_C2H2 377 399 2.99e-4 SMART
ZnF_C2H2 405 427 9.44e-2 SMART
ZnF_C2H2 433 455 3.26e-5 SMART
ZnF_C2H2 461 483 2.36e-2 SMART
ZnF_C2H2 489 511 7.9e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213797
AA Change: V501I

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: This gene encodes a protein containing eight C2H2-type zinc fingers and a BTB domain. Expression of this gene is induced by bone morphogenetic protein-2 signaling. Mutation of the related gene in humans causes immunodeficiency-centromeric instability-facial anomalies syndrome-2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a deletion in the BTB domain exhibit embryonic lethality between E4.5 and E9.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 G T 2: 103,397,861 (GRCm39) A264S probably benign Het
Atosa T C 9: 74,911,633 (GRCm39) C42R probably damaging Het
Atr G T 9: 95,744,844 (GRCm39) E54* probably null Het
Bmp4 A G 14: 46,621,456 (GRCm39) S363P probably damaging Het
Cfap54 C A 10: 92,773,590 (GRCm39) A2077S unknown Het
Chrna7 T C 7: 62,755,775 (GRCm39) D257G probably damaging Het
Chrnd C T 1: 87,118,780 (GRCm39) R46W probably damaging Het
Cntn2 A G 1: 132,444,824 (GRCm39) I851T probably damaging Het
Col3a1 T A 1: 45,372,817 (GRCm39) I534K unknown Het
Cyp3a25 A T 5: 145,939,870 (GRCm39) L46I probably benign Het
Dnah7b G C 1: 46,281,302 (GRCm39) G2788R probably damaging Het
Dnpep T C 1: 75,290,074 (GRCm39) E301G probably damaging Het
Efcab3 T C 11: 104,986,690 (GRCm39) S30P probably benign Het
Elk4 A G 1: 131,947,127 (GRCm39) I373V probably damaging Het
Fam161b T C 12: 84,395,420 (GRCm39) S508G probably damaging Het
Fgf10 A G 13: 118,925,659 (GRCm39) E146G probably benign Het
Fsip2 A G 2: 82,823,581 (GRCm39) D6438G possibly damaging Het
Garin2 C T 12: 78,758,982 (GRCm39) P101S probably benign Het
Gask1b T A 3: 79,794,114 (GRCm39) L194* probably null Het
Gm49355 T A 14: 12,296,672 (GRCm38) C10* probably null Het
Hfm1 A G 5: 107,049,569 (GRCm39) probably null Het
Hivep3 T C 4: 119,989,416 (GRCm39) S1956P probably damaging Het
Hrh2 A G 13: 54,375,270 (GRCm39) S369G unknown Het
Hspg2 T C 4: 137,260,872 (GRCm39) probably null Het
Hsph1 T C 5: 149,553,925 (GRCm39) Y181C probably damaging Het
Kcnh8 A G 17: 53,201,145 (GRCm39) probably null Het
Kctd1 C T 18: 15,195,700 (GRCm39) E308K possibly damaging Het
Kdm8 A T 7: 125,060,103 (GRCm39) Y335F probably damaging Het
Kif2b C G 11: 91,467,963 (GRCm39) G107R probably benign Het
Lama4 G A 10: 38,841,729 (GRCm39) probably benign Het
Lepr T C 4: 101,671,961 (GRCm39) V995A probably benign Het
Mfsd4a A T 1: 131,980,131 (GRCm39) V375E probably damaging Het
Mgl2 G T 11: 70,027,869 (GRCm39) W359L probably damaging Het
Muc5b C A 7: 141,414,798 (GRCm39) Y2581* probably null Het
Nol10 G T 12: 17,423,562 (GRCm39) probably null Het
Or4k47 T A 2: 111,451,538 (GRCm39) M294L probably benign Het
Or52n3 A T 7: 104,530,348 (GRCm39) K145* probably null Het
Otud3 C T 4: 138,636,865 (GRCm39) V99M probably damaging Het
Parvb T C 15: 84,187,672 (GRCm39) probably null Het
Pclo C A 5: 14,571,932 (GRCm39) P439Q possibly damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 (GRCm39) probably benign Het
Pkn1 A T 8: 84,419,302 (GRCm39) H100Q possibly damaging Het
Plce1 A T 19: 38,748,581 (GRCm39) I1771F probably damaging Het
Plxna2 G T 1: 194,483,366 (GRCm39) R1559L possibly damaging Het
Ppp2r3d T A 9: 101,003,621 (GRCm39) I416L possibly damaging Het
Pramel42 T A 5: 94,685,610 (GRCm39) Y423* probably null Het
Robo1 C A 16: 72,757,039 (GRCm39) C333* probably null Het
Ryr2 A T 13: 11,898,009 (GRCm39) Y129N probably damaging Het
Schip1 A T 3: 68,525,032 (GRCm39) K359M probably damaging Het
Schip1 G T 3: 68,525,033 (GRCm39) K359N probably damaging Het
Sh2d2a T A 3: 87,755,668 (GRCm39) S65T possibly damaging Het
Ssrp1 G A 2: 84,875,906 (GRCm39) M588I probably benign Het
Stim2 T A 5: 54,273,470 (GRCm39) C567S probably benign Het
Syne1 C A 10: 5,374,295 (GRCm39) A171S probably benign Het
Tigd3 A G 19: 5,943,050 (GRCm39) S27P probably benign Het
Vipr1 C A 9: 121,493,620 (GRCm39) Q224K probably damaging Het
Vmn1r75 T A 7: 11,614,475 (GRCm39) M69K possibly damaging Het
Vmn2r72 T G 7: 85,404,125 (GRCm39) D22A probably benign Het
Zbtb43 A G 2: 33,352,307 (GRCm39) F20S probably benign Het
Other mutations in Zbtb24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01312:Zbtb24 APN 10 41,327,885 (GRCm39) missense possibly damaging 0.63
R7189_Zbtb24_504 UTSW 10 41,340,472 (GRCm39) missense probably benign 0.00
BB009:Zbtb24 UTSW 10 41,327,504 (GRCm39) missense probably benign
BB019:Zbtb24 UTSW 10 41,327,504 (GRCm39) missense probably benign
R0485:Zbtb24 UTSW 10 41,340,532 (GRCm39) missense probably damaging 0.96
R0553:Zbtb24 UTSW 10 41,327,993 (GRCm39) missense possibly damaging 0.78
R0662:Zbtb24 UTSW 10 41,338,275 (GRCm39) missense probably damaging 1.00
R0927:Zbtb24 UTSW 10 41,327,432 (GRCm39) missense probably benign 0.43
R1164:Zbtb24 UTSW 10 41,340,523 (GRCm39) missense probably damaging 1.00
R1456:Zbtb24 UTSW 10 41,340,989 (GRCm39) missense possibly damaging 0.46
R1464:Zbtb24 UTSW 10 41,331,075 (GRCm39) missense probably damaging 1.00
R1464:Zbtb24 UTSW 10 41,331,075 (GRCm39) missense probably damaging 1.00
R1873:Zbtb24 UTSW 10 41,327,123 (GRCm39) missense probably benign 0.28
R2299:Zbtb24 UTSW 10 41,340,577 (GRCm39) missense probably damaging 1.00
R2371:Zbtb24 UTSW 10 41,327,264 (GRCm39) missense probably damaging 1.00
R4280:Zbtb24 UTSW 10 41,340,916 (GRCm39) missense probably benign 0.34
R4281:Zbtb24 UTSW 10 41,340,916 (GRCm39) missense probably benign 0.34
R4593:Zbtb24 UTSW 10 41,327,953 (GRCm39) missense possibly damaging 0.89
R4991:Zbtb24 UTSW 10 41,332,614 (GRCm39) splice site probably null
R5262:Zbtb24 UTSW 10 41,340,556 (GRCm39) nonsense probably null
R5371:Zbtb24 UTSW 10 41,327,537 (GRCm39) missense probably benign 0.01
R5393:Zbtb24 UTSW 10 41,340,578 (GRCm39) missense probably damaging 1.00
R5428:Zbtb24 UTSW 10 41,340,784 (GRCm39) missense probably benign
R5785:Zbtb24 UTSW 10 41,327,849 (GRCm39) missense probably benign 0.00
R6033:Zbtb24 UTSW 10 41,340,397 (GRCm39) missense probably damaging 1.00
R6033:Zbtb24 UTSW 10 41,340,397 (GRCm39) missense probably damaging 1.00
R6961:Zbtb24 UTSW 10 41,331,171 (GRCm39) missense probably damaging 1.00
R7407:Zbtb24 UTSW 10 41,340,775 (GRCm39) missense possibly damaging 0.94
R7932:Zbtb24 UTSW 10 41,327,504 (GRCm39) missense probably benign
R8074:Zbtb24 UTSW 10 41,327,228 (GRCm39) missense probably damaging 1.00
R9365:Zbtb24 UTSW 10 41,332,540 (GRCm39) missense probably damaging 0.98
R9484:Zbtb24 UTSW 10 41,327,429 (GRCm39) missense probably benign 0.01
Z1176:Zbtb24 UTSW 10 41,331,186 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCAAATGCTTCTCTGACTCC -3'
(R):5'- TGAATGTGCTCTGCCTGCTC -3'

Sequencing Primer
(F):5'- TCTCTGACTCCAGTGCCAAGAG -3'
(R):5'- TCCTGCTGAGCGGAAAGGATC -3'
Posted On 2019-06-26