Mutagenetix > Incidental Mutation

Incidental Mutation 'R7189:Zbtb24'

559504

Institutional Source

Beutler Lab

Gene Symbol

Zbtb24

Ensembl Gene

ENSMUSG00000019826

Gene Name

zinc finger and BTB domain containing 24

Synonyms

ZNF450

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7189 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

41450383-41465574 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 41464476 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 523 (V523I)

Ref Sequence

ENSEMBL: ENSMUSP00000079592 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080771] [ENSMUST00000213797]

AlphaFold

Q80X44

Predicted Effect

probably benign
Transcript: ENSMUST00000080771
AA Change: V523I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000079592
Gene: ENSMUSG00000019826
AA Change: V523I

Domain	Start	End	E-Value	Type
BTB	37	133	5.81e-26	SMART
AT_hook	159	171	2.23e-1	SMART
low complexity region	248	260	N/A	INTRINSIC
ZnF_C2H2	293	315	8.67e-1	SMART
ZnF_C2H2	321	343	4.87e-4	SMART
ZnF_C2H2	349	371	6.42e-4	SMART
ZnF_C2H2	377	399	2.99e-4	SMART
ZnF_C2H2	405	427	9.44e-2	SMART
ZnF_C2H2	433	455	3.26e-5	SMART
ZnF_C2H2	461	483	2.36e-2	SMART
ZnF_C2H2	489	511	7.9e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000213797
AA Change: V501I

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

95% (57/60)

MGI Phenotype

FUNCTION: This gene encodes a protein containing eight C2H2-type zinc fingers and a BTB domain. Expression of this gene is induced by bone morphogenetic protein-2 signaling. Mutation of the related gene in humans causes immunodeficiency-centromeric instability-facial anomalies syndrome-2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a deletion in the BTB domain exhibit embryonic lethality between E4.5 and E9.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abtb2	G	T	2: 103,567,516	A264S	probably benign	Het
Atr	G	T	9: 95,862,791	E54*	probably null	Het
Bmp4	A	G	14: 46,383,999	S363P	probably damaging	Het
Cfap54	C	A	10: 92,937,728	A2077S	unknown	Het
Chrna7	T	C	7: 63,106,027	D257G	probably damaging	Het
Chrnd	C	T	1: 87,191,058	R46W	probably damaging	Het
Cntn2	A	G	1: 132,517,086	I851T	probably damaging	Het
Col3a1	T	A	1: 45,333,657	I534K	unknown	Het
Cyp3a25	A	T	5: 146,003,060	L46I	probably benign	Het
Dnah7b	G	C	1: 46,242,142	G2788R	probably damaging	Het
Dnpep	T	C	1: 75,313,430	E301G	probably damaging	Het
Efcab3	T	C	11: 105,095,864	S30P	probably benign	Het
Elk4	A	G	1: 132,019,389	I373V	probably damaging	Het
Fam161b	T	C	12: 84,348,646	S508G	probably damaging	Het
Fam198b	T	A	3: 79,886,807	L194*	probably null	Het
Fam214a	T	C	9: 75,004,351	C42R	probably damaging	Het
Fam71d	C	T	12: 78,712,208	P101S	probably benign	Het
Fgf10	A	G	13: 118,789,123	E146G	probably benign	Het
Fsip2	A	G	2: 82,993,237	D6438G	possibly damaging	Het
Gm3139	T	A	5: 94,537,751	Y423*	probably null	Het
Gm49355	T	A	14: 12,296,672	C10*	probably null	Het
Hfm1	A	G	5: 106,901,703		probably null	Het
Hivep3	T	C	4: 120,132,219	S1956P	probably damaging	Het
Hrh2	A	G	13: 54,221,251	S369G	unknown	Het
Hspg2	T	C	4: 137,533,561		probably null	Het
Hsph1	T	C	5: 149,630,460	Y181C	probably damaging	Het
Kcnh8	A	G	17: 52,894,117		probably null	Het
Kctd1	C	T	18: 15,062,643	E308K	possibly damaging	Het
Kdm8	A	T	7: 125,460,931	Y335F	probably damaging	Het
Kif2b	C	G	11: 91,577,137	G107R	probably benign	Het
Lama4	G	A	10: 38,965,733		probably benign	Het
Lepr	T	C	4: 101,814,764	V995A	probably benign	Het
Mfsd4a	A	T	1: 132,052,393	V375E	probably damaging	Het
Mgl2	G	T	11: 70,137,043	W359L	probably damaging	Het
Muc5b	C	A	7: 141,861,061	Y2581*	probably null	Het
Nol10	G	T	12: 17,373,561		probably null	Het
Olfr1297	T	A	2: 111,621,193	M294L	probably benign	Het
Olfr665	A	T	7: 104,881,141	K145*	probably null	Het
Otud3	C	T	4: 138,909,554	V99M	probably damaging	Het
Parvb	T	C	15: 84,303,471		probably null	Het
Pclo	C	A	5: 14,521,918	P439Q	possibly damaging	Het
Peg10	CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC	CATC	6: 4,756,431		probably benign	Het
Pkn1	A	T	8: 83,692,673	H100Q	possibly damaging	Het
Plce1	A	T	19: 38,760,137	I1771F	probably damaging	Het
Plxna2	G	T	1: 194,801,058	R1559L	possibly damaging	Het
Ppp2r3a	T	A	9: 101,126,422	I416L	possibly damaging	Het
Robo1	C	A	16: 72,960,151	C333*	probably null	Het
Ryr2	A	T	13: 11,883,123	Y129N	probably damaging	Het
Schip1	A	T	3: 68,617,699	K359M	probably damaging	Het
Schip1	G	T	3: 68,617,700	K359N	probably damaging	Het
Sh2d2a	T	A	3: 87,848,361	S65T	possibly damaging	Het
Ssrp1	G	A	2: 85,045,562	M588I	probably benign	Het
Stim2	T	A	5: 54,116,128	C567S	probably benign	Het
Syne1	C	A	10: 5,424,295	A171S	probably benign	Het
Tigd3	A	G	19: 5,893,022	S27P	probably benign	Het
Vipr1	C	A	9: 121,664,554	Q224K	probably damaging	Het
Vmn1r75	T	A	7: 11,880,548	M69K	possibly damaging	Het
Vmn2r72	T	G	7: 85,754,917	D22A	probably benign	Het
Zbtb43	A	G	2: 33,462,295	F20S	probably benign	Het

Other mutations in Zbtb24

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01312:Zbtb24	APN	10	41451889	missense	possibly damaging	0.63
R7189_Zbtb24_504	UTSW	10	41464476	missense	probably benign	0.00
BB009:Zbtb24	UTSW	10	41451508	missense	probably benign
BB019:Zbtb24	UTSW	10	41451508	missense	probably benign
R0485:Zbtb24	UTSW	10	41464536	missense	probably damaging	0.96
R0553:Zbtb24	UTSW	10	41451997	missense	possibly damaging	0.78
R0662:Zbtb24	UTSW	10	41462279	missense	probably damaging	1.00
R0927:Zbtb24	UTSW	10	41451436	missense	probably benign	0.43
R1164:Zbtb24	UTSW	10	41464527	missense	probably damaging	1.00
R1456:Zbtb24	UTSW	10	41464993	missense	possibly damaging	0.46
R1464:Zbtb24	UTSW	10	41455079	missense	probably damaging	1.00
R1464:Zbtb24	UTSW	10	41455079	missense	probably damaging	1.00
R1873:Zbtb24	UTSW	10	41451127	missense	probably benign	0.28
R2299:Zbtb24	UTSW	10	41464581	missense	probably damaging	1.00
R2371:Zbtb24	UTSW	10	41451268	missense	probably damaging	1.00
R4280:Zbtb24	UTSW	10	41464920	missense	probably benign	0.34
R4281:Zbtb24	UTSW	10	41464920	missense	probably benign	0.34
R4593:Zbtb24	UTSW	10	41451957	missense	possibly damaging	0.89
R4991:Zbtb24	UTSW	10	41456618	splice site	probably null
R5262:Zbtb24	UTSW	10	41464560	nonsense	probably null
R5371:Zbtb24	UTSW	10	41451541	missense	probably benign	0.01
R5393:Zbtb24	UTSW	10	41464582	missense	probably damaging	1.00
R5428:Zbtb24	UTSW	10	41464788	missense	probably benign
R5785:Zbtb24	UTSW	10	41451853	missense	probably benign	0.00
R6033:Zbtb24	UTSW	10	41464401	missense	probably damaging	1.00
R6033:Zbtb24	UTSW	10	41464401	missense	probably damaging	1.00
R6961:Zbtb24	UTSW	10	41455175	missense	probably damaging	1.00
R7407:Zbtb24	UTSW	10	41464779	missense	possibly damaging	0.94
R7932:Zbtb24	UTSW	10	41451508	missense	probably benign
R8074:Zbtb24	UTSW	10	41451232	missense	probably damaging	1.00
R9365:Zbtb24	UTSW	10	41456544	missense	probably damaging	0.98
R9484:Zbtb24	UTSW	10	41451433	missense	probably benign	0.01
Z1176:Zbtb24	UTSW	10	41455190	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGCAAATGCTTCTCTGACTCC -3'
(R):5'- TGAATGTGCTCTGCCTGCTC -3'

Sequencing Primer
(F):5'- TCTCTGACTCCAGTGCCAAGAG -3'
(R):5'- TCCTGCTGAGCGGAAAGGATC -3'

Posted On

2019-06-26