Incidental Mutation 'R7189:Tigd3'
ID559520
Institutional Source Beutler Lab
Gene Symbol Tigd3
Ensembl Gene ENSMUSG00000044390
Gene Nametigger transposable element derived 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.741) question?
Stock #R7189 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location5891139-5894107 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5893022 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 27 (S27P)
Ref Sequence ENSEMBL: ENSMUSP00000059302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055911] [ENSMUST00000118623] [ENSMUST00000136983]
Predicted Effect probably benign
Transcript: ENSMUST00000025746
SMART Domains Protein: ENSMUSP00000025746
Gene: ENSMUSG00000024826

DomainStartEndE-ValueType
Pfam:Requiem_N 1 40 1.4e-19 PFAM
low complexity region 115 131 N/A INTRINSIC
low complexity region 134 152 N/A INTRINSIC
ZnF_C2H2 165 188 4.47e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000055911
AA Change: S27P

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000059302
Gene: ENSMUSG00000044390
AA Change: S27P

DomainStartEndE-ValueType
Pfam:CENP-B_N 6 59 2.5e-15 PFAM
CENPB 73 137 2.96e-7 SMART
Pfam:DDE_1 192 360 7.4e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118623
SMART Domains Protein: ENSMUSP00000113465
Gene: ENSMUSG00000024826

DomainStartEndE-ValueType
Pfam:Requiem_N 13 84 7.9e-40 PFAM
low complexity region 159 175 N/A INTRINSIC
low complexity region 178 196 N/A INTRINSIC
PDB:3IUF|A 203 263 1e-21 PDB
PHD 286 342 8.64e-9 SMART
RING 287 341 3.83e0 SMART
PHD 343 389 8.9e-11 SMART
RING 344 388 9.75e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136983
SMART Domains Protein: ENSMUSP00000120125
Gene: ENSMUSG00000024826

DomainStartEndE-ValueType
Pfam:Requiem_N 12 85 6.2e-41 PFAM
low complexity region 159 175 N/A INTRINSIC
low complexity region 178 196 N/A INTRINSIC
ZnF_C2H2 209 232 4.47e-3 SMART
PHD 272 328 8.64e-9 SMART
RING 273 327 3.83e0 SMART
PHD 329 375 8.9e-11 SMART
RING 330 374 9.75e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the tigger subfamily of the pogo superfamily of DNA-mediated transposons in humans. These proteins are related to DNA transposons found in fungi and nematodes, and more distantly to the Tc1 and mariner transposases. They are also very similar to the major mammalian centromere protein B. The exact function of this gene is not known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 G T 2: 103,567,516 A264S probably benign Het
Atr G T 9: 95,862,791 E54* probably null Het
Bmp4 A G 14: 46,383,999 S363P probably damaging Het
Cfap54 C A 10: 92,937,728 A2077S unknown Het
Chrna7 T C 7: 63,106,027 D257G probably damaging Het
Chrnd C T 1: 87,191,058 R46W probably damaging Het
Cntn2 A G 1: 132,517,086 I851T probably damaging Het
Col3a1 T A 1: 45,333,657 I534K unknown Het
Cyp3a25 A T 5: 146,003,060 L46I probably benign Het
Dnah7b G C 1: 46,242,142 G2788R probably damaging Het
Dnpep T C 1: 75,313,430 E301G probably damaging Het
Efcab3 T C 11: 105,095,864 S30P probably benign Het
Elk4 A G 1: 132,019,389 I373V probably damaging Het
Fam161b T C 12: 84,348,646 S508G probably damaging Het
Fam198b T A 3: 79,886,807 L194* probably null Het
Fam214a T C 9: 75,004,351 C42R probably damaging Het
Fam71d C T 12: 78,712,208 P101S probably benign Het
Fgf10 A G 13: 118,789,123 E146G probably benign Het
Fsip2 A G 2: 82,993,237 D6438G possibly damaging Het
Gm3139 T A 5: 94,537,751 Y423* probably null Het
Gm49355 T A 14: 12,296,672 C10* probably null Het
Hfm1 A G 5: 106,901,703 probably null Het
Hivep3 T C 4: 120,132,219 S1956P probably damaging Het
Hrh2 A G 13: 54,221,251 S369G unknown Het
Hspg2 T C 4: 137,533,561 probably null Het
Hsph1 T C 5: 149,630,460 Y181C probably damaging Het
Kcnh8 A G 17: 52,894,117 probably null Het
Kctd1 C T 18: 15,062,643 E308K possibly damaging Het
Kdm8 A T 7: 125,460,931 Y335F probably damaging Het
Kif2b C G 11: 91,577,137 G107R probably benign Het
Lama4 G A 10: 38,965,733 probably benign Het
Lepr T C 4: 101,814,764 V995A probably benign Het
Mfsd4a A T 1: 132,052,393 V375E probably damaging Het
Mgl2 G T 11: 70,137,043 W359L probably damaging Het
Muc5b C A 7: 141,861,061 Y2581* probably null Het
Nol10 G T 12: 17,373,561 probably null Het
Olfr1297 T A 2: 111,621,193 M294L probably benign Het
Olfr665 A T 7: 104,881,141 K145* probably null Het
Otud3 C T 4: 138,909,554 V99M probably damaging Het
Parvb T C 15: 84,303,471 probably null Het
Pclo C A 5: 14,521,918 P439Q possibly damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Pkn1 A T 8: 83,692,673 H100Q possibly damaging Het
Plce1 A T 19: 38,760,137 I1771F probably damaging Het
Plxna2 G T 1: 194,801,058 R1559L possibly damaging Het
Ppp2r3a T A 9: 101,126,422 I416L possibly damaging Het
Robo1 C A 16: 72,960,151 C333* probably null Het
Ryr2 A T 13: 11,883,123 Y129N probably damaging Het
Schip1 A T 3: 68,617,699 K359M probably damaging Het
Schip1 G T 3: 68,617,700 K359N probably damaging Het
Sh2d2a T A 3: 87,848,361 S65T possibly damaging Het
Ssrp1 G A 2: 85,045,562 M588I probably benign Het
Stim2 T A 5: 54,116,128 C567S probably benign Het
Syne1 C A 10: 5,424,295 A171S probably benign Het
Vipr1 C A 9: 121,664,554 Q224K probably damaging Het
Vmn1r75 T A 7: 11,880,548 M69K possibly damaging Het
Vmn2r72 T G 7: 85,754,917 D22A probably benign Het
Zbtb24 G A 10: 41,464,476 V523I probably benign Het
Zbtb43 A G 2: 33,462,295 F20S probably benign Het
Other mutations in Tigd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0456:Tigd3 UTSW 19 5892793 missense probably damaging 1.00
R0699:Tigd3 UTSW 19 5891946 missense probably benign
R1416:Tigd3 UTSW 19 5891725 missense probably benign
R3945:Tigd3 UTSW 19 5892433 missense probably damaging 0.98
R5945:Tigd3 UTSW 19 5891866 missense probably benign
R6253:Tigd3 UTSW 19 5892842 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACATGGGCCCCGTTACATC -3'
(R):5'- CTGCATTCCAGAGAATTGCTC -3'

Sequencing Primer
(F):5'- TGGTACCAGCACAGTAGAGCC -3'
(R):5'- AGAATTGCTCTGGCTTCAGG -3'
Posted On2019-06-26