Mutagenetix > Incidental Mutations

Incidental Mutation 'R7190:Armc3'

559525

Institutional Source

Beutler Lab

Gene Symbol

Armc3

Ensembl Gene

ENSMUSG00000037683

Gene Name

armadillo repeat containing 3

Synonyms

4921513G22Rik

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_001081083.2, NM_001271563.1, NM_001271564.1, NM_001271565.1; MGI:1918132

Is this an essential gene?

Probably non essential (E-score: 0.083) question?

Stock #

R7190 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

19199302-19310241 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 19293136 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 573 (Y573N)

Ref Sequence

ENSEMBL: ENSMUSP00000110287 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049255] [ENSMUST00000114640]

AlphaFold

A2AU72

Predicted Effect

probably damaging
Transcript: ENSMUST00000049255
AA Change: Y573N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000048784
Gene: ENSMUSG00000037683
AA Change: Y573N

Domain	Start	End	E-Value	Type
low complexity region	3	14	N/A	INTRINSIC
ARM	56	96	2.07e-2	SMART
ARM	97	138	9.84e1	SMART
ARM	139	179	7.86e-3	SMART
ARM	180	220	7.63e0	SMART
ARM	221	262	7.76e1	SMART
low complexity region	293	303	N/A	INTRINSIC
ARM	305	345	3.91e1	SMART
ARM	346	385	2.93e-2	SMART
ARM	387	427	7.74e-2	SMART
Blast:ARM	428	468	3e-11	BLAST
ARM	469	509	1.45e-1	SMART
low complexity region	544	557	N/A	INTRINSIC
low complexity region	583	595	N/A	INTRINSIC
low complexity region	620	639	N/A	INTRINSIC
low complexity region	675	696	N/A	INTRINSIC
Pfam:EDR1	723	857	3.1e-28	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000114640
AA Change: Y573N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000110287
Gene: ENSMUSG00000037683
AA Change: Y573N

Domain	Start	End	E-Value	Type
low complexity region	3	14	N/A	INTRINSIC
ARM	56	96	2.07e-2	SMART
ARM	97	138	9.84e1	SMART
ARM	139	179	7.86e-3	SMART
ARM	180	220	7.63e0	SMART
ARM	221	262	7.76e1	SMART
low complexity region	293	303	N/A	INTRINSIC
ARM	305	345	3.91e1	SMART
ARM	346	385	2.93e-2	SMART
ARM	387	427	7.74e-2	SMART
Blast:ARM	428	468	3e-11	BLAST
ARM	469	509	1.45e-1	SMART
Pfam:EDR1	549	868	1.4e-41	PFAM

Meta Mutation Damage Score

0.3865

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.5%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Armadillo/beta-catenin (CTNNB1; MIM 116806)-like (ARM) domains are imperfect 45-amino acid repeats involved in protein-protein interactions. ARM domain-containing proteins, such as ARMC3, function in signal transduction, development, cell adhesion and mobility, and tumor initiation and metastasis (Li et al., 2006 [PubMed 16915934]).[supplied by OMIM, Mar 2008]

Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Add3	C	T	19: 53,216,899	R27*	probably null	Het
BC024978	G	A	7: 27,201,123	A176T	probably damaging	Het
Bod1l	A	C	5: 41,819,938	N1344K	probably benign	Het
Camta1	T	G	4: 151,148,523	N231T	possibly damaging	Het
Capza2	T	A	6: 17,654,121	Y57*	probably null	Het
Ccdc186	T	A	19: 56,792,000	I871F	probably damaging	Het
Cntnap5b	A	G	1: 100,431,849		probably null	Het
Dnah2	G	T	11: 69,549,097		probably null	Het
Fhod3	T	C	18: 25,090,755	F1053L	probably damaging	Het
Foxj1	A	G	11: 116,332,375	Y201H	possibly damaging	Het
Gatad2b	T	A	3: 90,350,415	I210N	probably benign	Het
Gba	T	A	3: 89,204,362	I112N	probably damaging	Het
Gbp2	T	C	3: 142,633,447	V420A	probably benign	Het
Gm3106	T	G	5: 94,218,237	N71K	probably benign	Het
Gm8251	A	C	1: 44,061,615	S108A	probably benign	Het
Golga3	T	A	5: 110,209,855	H1072Q	probably damaging	Het
Gpr150	C	T	13: 76,055,873	A318T	probably benign	Het
Gpr6	T	C	10: 41,070,960	N209D	probably damaging	Het
Grin2b	T	C	6: 135,732,948	N1200S	possibly damaging	Het
Ifi207	G	A	1: 173,730,252	H307Y	unknown	Het
Il20ra	A	T	10: 19,742,941	I46F	probably damaging	Het
Lvrn	A	G	18: 46,900,503	D927G	probably benign	Het
Nlrc4	G	T	17: 74,445,203	D728E	probably damaging	Het
Nup107	T	C	10: 117,762,135	D630G	probably benign	Het
Olfr378	A	T	11: 73,425,164	I273N	probably benign	Het
Olfr787	T	C	10: 129,462,757	I27T	probably benign	Het
Pclo	C	A	5: 14,679,729	A2867D	unknown	Het
Perm1	A	G	4: 156,219,815	T754A	possibly damaging	Het
Plpbp	G	T	8: 27,051,297	V162L	probably benign	Het
Plscr4	A	T	9: 92,488,641	E220D	probably benign	Het
Ppp2r3a	A	T	9: 101,212,527	M199K	probably benign	Het
Rassf6	T	C	5: 90,606,807	E204G	probably damaging	Het
Reln	A	C	5: 22,047,947	D667E	probably damaging	Het
Rere	A	G	4: 150,610,953	I462V	unknown	Het
Rpain	A	G	11: 70,971,909	E76G	possibly damaging	Het
Strc	T	G	2: 121,369,026	I1311L	probably benign	Het
Svil	A	G	18: 5,092,937	M1385V	probably benign	Het
Syne2	T	A	12: 76,066,587	D1083E	probably benign	Het
Szt2	T	A	4: 118,389,006	H986L	probably damaging	Het
Tcl1b2	G	T	12: 105,147,234		probably null	Het
Thy1	T	A	9: 44,046,925	S117T	possibly damaging	Het
Tmem183a	A	T	1: 134,354,758	I203N	probably damaging	Het
Tmprss11g	T	C	5: 86,496,632	I118V	probably benign	Het
Tsen34	T	C	7: 3,694,807	V69A	possibly damaging	Het
Ttn	T	C	2: 76,886,799	Q7506R	unknown	Het
Vmn1r184	T	C	7: 26,267,680	S284P	probably damaging	Het
Wdr19	A	G	5: 65,240,862	D810G	probably benign	Het
Zer1	T	C	2: 30,103,432	D554G	probably damaging	Het
Zfp626	A	T	7: 27,818,343	T250S	probably benign	Het

Other mutations in Armc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00535:Armc3	APN	2	19303858	missense	possibly damaging	0.48
IGL01123:Armc3	APN	2	19201805	missense	possibly damaging	0.87
IGL01142:Armc3	APN	2	19297898	splice site	probably benign
IGL01556:Armc3	APN	2	19269146	missense	probably damaging	1.00
IGL02145:Armc3	APN	2	19296860	missense	possibly damaging	0.81
IGL02145:Armc3	APN	2	19286137	critical splice donor site	probably null
IGL02152:Armc3	APN	2	19286137	critical splice donor site	probably null
IGL02154:Armc3	APN	2	19286137	critical splice donor site	probably null
IGL02243:Armc3	APN	2	19286137	critical splice donor site	probably null
IGL02244:Armc3	APN	2	19286137	critical splice donor site	probably null
IGL02516:Armc3	APN	2	19300506	missense	possibly damaging	0.94
IGL02691:Armc3	APN	2	19235484	missense	probably damaging	1.00
IGL03151:Armc3	APN	2	19238698	missense	probably damaging	1.00
IGL03190:Armc3	APN	2	19288950	missense	probably damaging	0.99
IGL03288:Armc3	APN	2	19235482	missense	probably damaging	1.00
IGL03338:Armc3	APN	2	19248701	missense	possibly damaging	0.88
R0015:Armc3	UTSW	2	19296321	critical splice acceptor site	probably null
R0015:Armc3	UTSW	2	19296321	critical splice acceptor site	probably null
R0256:Armc3	UTSW	2	19269216	missense	probably damaging	1.00
R0621:Armc3	UTSW	2	19295393	missense	probably damaging	0.96
R1326:Armc3	UTSW	2	19310124	makesense	probably null
R1470:Armc3	UTSW	2	19238736	missense	probably benign
R1470:Armc3	UTSW	2	19238736	missense	probably benign
R1489:Armc3	UTSW	2	19310047	missense	probably benign	0.01
R1990:Armc3	UTSW	2	19293142	missense	probably damaging	0.97
R1991:Armc3	UTSW	2	19293142	missense	probably damaging	0.97
R1992:Armc3	UTSW	2	19293142	missense	probably damaging	0.97
R2002:Armc3	UTSW	2	19288936	missense	probably benign	0.01
R2095:Armc3	UTSW	2	19288929	missense	possibly damaging	0.65
R2127:Armc3	UTSW	2	19201811	missense	probably damaging	1.00
R2158:Armc3	UTSW	2	19248633	missense	probably damaging	0.99
R2697:Armc3	UTSW	2	19303935	missense	probably damaging	1.00
R3809:Armc3	UTSW	2	19300665	missense	probably damaging	1.00
R3897:Armc3	UTSW	2	19269177	missense	probably damaging	1.00
R4107:Armc3	UTSW	2	19288909	missense	probably benign	0.13
R4326:Armc3	UTSW	2	19300473	missense	probably damaging	0.97
R4464:Armc3	UTSW	2	19248659	missense	probably damaging	0.99
R4702:Armc3	UTSW	2	19309981	missense	probably damaging	1.00
R4923:Armc3	UTSW	2	19292980	critical splice acceptor site	probably null
R5370:Armc3	UTSW	2	19286062	missense	probably benign	0.00
R5518:Armc3	UTSW	2	19297928	missense	probably benign	0.28
R5718:Armc3	UTSW	2	19303799	nonsense	probably null
R5739:Armc3	UTSW	2	19253917	missense	possibly damaging	0.67
R5913:Armc3	UTSW	2	19310047	missense	possibly damaging	0.65
R6211:Armc3	UTSW	2	19296803	critical splice acceptor site	probably null
R6245:Armc3	UTSW	2	19248705	missense	probably damaging	1.00
R6841:Armc3	UTSW	2	19201819	splice site	probably null
R7003:Armc3	UTSW	2	19270028	missense	probably damaging	1.00
R7499:Armc3	UTSW	2	19285979	missense	probably benign	0.03
R7738:Armc3	UTSW	2	19288950	missense	probably damaging	0.99
R7844:Armc3	UTSW	2	19254018	missense	possibly damaging	0.90
R7919:Armc3	UTSW	2	19286095	missense	probably benign	0.00
R8060:Armc3	UTSW	2	19288909	missense	probably benign	0.08
R8111:Armc3	UTSW	2	19296863	missense	probably benign
R8406:Armc3	UTSW	2	19235554	missense	probably damaging	0.98
R8485:Armc3	UTSW	2	19293134	missense	probably damaging	1.00
R8773:Armc3	UTSW	2	19288856	missense	probably benign	0.01
R8940:Armc3	UTSW	2	19235582	missense	probably damaging	1.00
R9441:Armc3	UTSW	2	19248615	missense	possibly damaging	0.89
Z1177:Armc3	UTSW	2	19285991	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GGGAACTCAATGTCTGTTGGC -3'
(R):5'- AAATGAGCTTTTGTGGAGGAGC -3'

Sequencing Primer
(F):5'- CTCAATGTCTGTTGGCTTGGAGAAAG -3'
(R):5'- CTGAGACTGTGATTAATAAGCTGAC -3'

Posted On

2019-06-26