Incidental Mutation 'R7190:Gba'
ID559529
Institutional Source Beutler Lab
Gene Symbol Gba
Ensembl Gene ENSMUSG00000028048
Gene Nameglucosidase, beta, acid
Synonymsglucocerebrosidase, GCase, GC, betaGC, GBA1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.735) question?
Stock #R7190 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location89202928-89208966 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89204362 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 112 (I112N)
Ref Sequence ENSEMBL: ENSMUSP00000076589 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073572] [ENSMUST00000077367] [ENSMUST00000118964] [ENSMUST00000167998] [ENSMUST00000174126] [ENSMUST00000197738]
Predicted Effect probably benign
Transcript: ENSMUST00000073572
SMART Domains Protein: ENSMUSP00000073261
Gene: ENSMUSG00000064068

DomainStartEndE-ValueType
low complexity region 94 109 N/A INTRINSIC
Pfam:Tom37 151 219 4.2e-21 PFAM
Pfam:Tom37_C 239 317 8.1e-24 PFAM
Pfam:GST_C_3 267 383 1.7e-11 PFAM
Pfam:GST_C_2 270 377 2.7e-8 PFAM
Pfam:Tom37_C 300 369 1.1e-14 PFAM
low complexity region 396 415 N/A INTRINSIC
transmembrane domain 416 438 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000077367
AA Change: I112N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076589
Gene: ENSMUSG00000028048
AA Change: I112N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Glyco_hydro_30 20 512 1.4e-252 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118964
SMART Domains Protein: ENSMUSP00000114009
Gene: ENSMUSG00000064068

DomainStartEndE-ValueType
low complexity region 94 109 N/A INTRINSIC
Pfam:Tom37 151 219 5.9e-21 PFAM
Pfam:Tom37_C 216 287 6.3e-19 PFAM
Pfam:GST_C_3 216 352 5.1e-11 PFAM
Pfam:GST_C_2 238 344 1.9e-8 PFAM
Pfam:Tom37_C 269 338 9.5e-15 PFAM
low complexity region 365 384 N/A INTRINSIC
transmembrane domain 385 407 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119222
SMART Domains Protein: ENSMUSP00000113986
Gene: ENSMUSG00000064068

DomainStartEndE-ValueType
Pfam:Tom37 12 57 1.6e-11 PFAM
Pfam:Tom37_C 138 216 5.4e-24 PFAM
Pfam:GST_C_3 166 282 1.1e-11 PFAM
Pfam:GST_C_2 169 276 1.8e-8 PFAM
Pfam:Tom37_C 199 268 7.2e-15 PFAM
low complexity region 295 314 N/A INTRINSIC
transmembrane domain 315 337 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129055
Predicted Effect probably damaging
Transcript: ENSMUST00000167998
AA Change: I112N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130660
Gene: ENSMUSG00000028048
AA Change: I112N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Glyco_hydro_30 20 512 1.4e-252 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173475
SMART Domains Protein: ENSMUSP00000134110
Gene: ENSMUSG00000064068

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
low complexity region 97 116 N/A INTRINSIC
transmembrane domain 117 139 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173477
SMART Domains Protein: ENSMUSP00000133282
Gene: ENSMUSG00000064068

DomainStartEndE-ValueType
Pfam:Tom37 1 58 8.5e-16 PFAM
Pfam:Tom37_C 77 155 9.7e-24 PFAM
Pfam:GST_C_3 104 221 8.2e-12 PFAM
Pfam:GST_C_2 107 216 7.5e-9 PFAM
Pfam:Tom37_C 138 207 1.3e-14 PFAM
low complexity region 234 253 N/A INTRINSIC
transmembrane domain 254 276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173593
SMART Domains Protein: ENSMUSP00000133866
Gene: ENSMUSG00000064068

DomainStartEndE-ValueType
Pfam:Tom37 14 82 1.1e-21 PFAM
Pfam:Tom37_C 102 178 3.4e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174126
SMART Domains Protein: ENSMUSP00000133291
Gene: ENSMUSG00000064068

DomainStartEndE-ValueType
Pfam:Tom37_C 1 74 7.6e-23 PFAM
Pfam:GST_C_3 7 143 7.3e-12 PFAM
Pfam:GST_C_2 26 137 2.8e-9 PFAM
Pfam:Tom37_C 61 129 6.2e-15 PFAM
low complexity region 159 169 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000197738
AA Change: I112N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142401
Gene: ENSMUSG00000028048
AA Change: I112N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Glyco_hydro_30 20 388 1e-186 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lysosomal membrane protein that cleaves the beta-glucosidic linkage of glycosylceramide, an intermediate in glycolipid metabolism. Mutations in this gene cause Gaucher disease, a lysosomal storage disease characterized by an accumulation of glucocerebrosides. A related pseudogene is approximately 12 kb downstream of this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mutations in this locus variably lower enzyme activity and result in accumulated glucocerebroside in reticuloendotehelial cell lysosomes and glucosylceramide in brain, liver and skin. Severe mutants die perinatally with compromised epidermal permeability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add3 C T 19: 53,216,899 R27* probably null Het
Armc3 T A 2: 19,293,136 Y573N probably damaging Het
BC024978 G A 7: 27,201,123 A176T probably damaging Het
Bod1l A C 5: 41,819,938 N1344K probably benign Het
Camta1 T G 4: 151,148,523 N231T possibly damaging Het
Capza2 T A 6: 17,654,121 Y57* probably null Het
Ccdc186 T A 19: 56,792,000 I871F probably damaging Het
Cntnap5b A G 1: 100,431,849 probably null Het
Dnah2 G T 11: 69,549,097 probably null Het
Fhod3 T C 18: 25,090,755 F1053L probably damaging Het
Foxj1 A G 11: 116,332,375 Y201H possibly damaging Het
Gatad2b T A 3: 90,350,415 I210N probably benign Het
Gbp2 T C 3: 142,633,447 V420A probably benign Het
Gm3106 T G 5: 94,218,237 N71K probably benign Het
Gm8251 A C 1: 44,061,615 S108A probably benign Het
Golga3 T A 5: 110,209,855 H1072Q probably damaging Het
Gpr150 C T 13: 76,055,873 A318T probably benign Het
Gpr6 T C 10: 41,070,960 N209D probably damaging Het
Grin2b T C 6: 135,732,948 N1200S possibly damaging Het
Ifi207 G A 1: 173,730,252 H307Y unknown Het
Il20ra A T 10: 19,742,941 I46F probably damaging Het
Lvrn A G 18: 46,900,503 D927G probably benign Het
Nlrc4 G T 17: 74,445,203 D728E probably damaging Het
Nup107 T C 10: 117,762,135 D630G probably benign Het
Olfr378 A T 11: 73,425,164 I273N probably benign Het
Olfr787 T C 10: 129,462,757 I27T probably benign Het
Pclo C A 5: 14,679,729 A2867D unknown Het
Perm1 A G 4: 156,219,815 T754A possibly damaging Het
Plpbp G T 8: 27,051,297 V162L probably benign Het
Plscr4 A T 9: 92,488,641 E220D probably benign Het
Ppp2r3a A T 9: 101,212,527 M199K probably benign Het
Rassf6 T C 5: 90,606,807 E204G probably damaging Het
Reln A C 5: 22,047,947 D667E probably damaging Het
Rere A G 4: 150,610,953 I462V unknown Het
Rpain A G 11: 70,971,909 E76G possibly damaging Het
Strc T G 2: 121,369,026 I1311L probably benign Het
Svil A G 18: 5,092,937 M1385V probably benign Het
Syne2 T A 12: 76,066,587 D1083E probably benign Het
Szt2 T A 4: 118,389,006 H986L probably damaging Het
Tcl1b2 G T 12: 105,147,234 probably null Het
Thy1 T A 9: 44,046,925 S117T possibly damaging Het
Tmem183a A T 1: 134,354,758 I203N probably damaging Het
Tmprss11g T C 5: 86,496,632 I118V probably benign Het
Tsen34 T C 7: 3,694,807 V69A possibly damaging Het
Ttn T C 2: 76,886,799 Q7506R unknown Het
Vmn1r184 T C 7: 26,267,680 S284P probably damaging Het
Wdr19 A G 5: 65,240,862 D810G probably benign Het
Zer1 T C 2: 30,103,432 D554G probably damaging Het
Zfp626 A T 7: 27,818,343 T250S probably benign Het
Other mutations in Gba
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02142:Gba APN 3 89205841 missense probably damaging 1.00
IGL02661:Gba APN 3 89203527 missense probably benign 0.02
IGL02832:Gba APN 3 89203502 missense probably benign
R0308:Gba UTSW 3 89208364 missense probably benign 0.00
R0811:Gba UTSW 3 89204000 missense probably benign 0.01
R0812:Gba UTSW 3 89204000 missense probably benign 0.01
R1517:Gba UTSW 3 89206148 missense probably damaging 1.00
R2119:Gba UTSW 3 89205561 missense probably benign 0.11
R4613:Gba UTSW 3 89208644 utr 3 prime probably null
R5371:Gba UTSW 3 89205471 missense probably benign 0.37
R5987:Gba UTSW 3 89205822 missense probably damaging 0.98
R6469:Gba UTSW 3 89204081 missense probably benign 0.12
R6470:Gba UTSW 3 89204081 missense probably benign 0.12
R6473:Gba UTSW 3 89204081 missense probably benign 0.12
R6474:Gba UTSW 3 89204081 missense probably benign 0.12
R6475:Gba UTSW 3 89205928 missense probably benign 0.00
R6483:Gba UTSW 3 89208603 missense probably damaging 1.00
Z1176:Gba UTSW 3 89204005 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCACAGGTAGCCACTTTATCTGTC -3'
(R):5'- CCCGAAAATTGTCCTCTGACC -3'

Sequencing Primer
(F):5'- GTCCCTCTAAGCCTGGACC -3'
(R):5'- GAAAATTGTCCTCTGACCTCCCC -3'
Posted On2019-06-26