Incidental Mutation 'R0591:Dgkd'
Institutional Source Beutler Lab
Gene Symbol Dgkd
Ensembl Gene ENSMUSG00000070738
Gene Namediacylglycerol kinase, delta
Synonymsdgkd-2, DGKdelta, AI841987, D330025K09
MMRRC Submission 038781-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.701) question?
Stock #R0591 (G1)
Quality Score169
Status Validated
Chromosomal Location87853287-87945180 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87915104 bp
Amino Acid Change Isoleucine to Asparagine at position 118 (I118N)
Ref Sequence ENSEMBL: ENSMUSP00000027517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027517]
Predicted Effect probably damaging
Transcript: ENSMUST00000027517
AA Change: I118N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000027517
Gene: ENSMUSG00000070738
AA Change: I118N

low complexity region 2 36 N/A INTRINSIC
PH 54 148 1.7e-16 SMART
C1 164 213 2.48e-15 SMART
low complexity region 221 232 N/A INTRINSIC
C1 236 286 8.56e-10 SMART
DAGKc 321 446 9.44e-62 SMART
low complexity region 691 710 N/A INTRINSIC
DAGKa 765 922 1.25e-98 SMART
low complexity region 1128 1139 N/A INTRINSIC
SAM 1148 1214 2.16e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190243
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191589
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.2%
  • 10x: 97.7%
  • 20x: 95.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic enzyme that phosphorylates diacylglycerol to produce phosphatidic acid. Diacylglycerol and phosphatidic acid are two lipids that act as second messengers in signaling cascades. Their cellular concentrations are regulated by the encoded protein, and so it is thought to play an important role in cellular signal transduction. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele are born with open eyelids and reduced body size, develop respiratory distress and die within 24 hrs of birth. Half of mice homozygous for a hypomorphic gene trap allele exhibit abnormal epileptic discharges and seizureswhile 9% of aging homozygotes develop tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G T 3: 138,068,943 E1298* probably null Het
Adam19 T C 11: 46,121,411 probably benign Het
Agt A T 8: 124,556,939 S480R possibly damaging Het
Anapc1 G T 2: 128,619,332 D1769E probably benign Het
Aox4 T C 1: 58,239,102 probably benign Het
Apol9b G A 15: 77,735,630 V209I possibly damaging Het
Appl2 A T 10: 83,624,645 I116K possibly damaging Het
B230118H07Rik A T 2: 101,576,117 D155E probably benign Het
BC051665 A G 13: 60,784,608 probably benign Het
Cactin G T 10: 81,324,003 E89* probably null Het
Carf G T 1: 60,125,914 probably benign Het
Ccdc167 A G 17: 29,705,261 probably benign Het
Ceacam3 G A 7: 17,151,883 probably null Het
Clca4b T A 3: 144,915,592 K574* probably null Het
Crabp1 T A 9: 54,765,603 I64N probably damaging Het
Dglucy T C 12: 100,859,518 probably benign Het
Dock10 C T 1: 80,541,219 probably benign Het
Ednrb A T 14: 103,823,274 probably null Het
Ercc6 T C 14: 32,558,016 probably benign Het
Gm5538 C A 3: 59,752,129 Y334* probably null Het
Golga3 A C 5: 110,188,743 Q416P probably damaging Het
Gpr12 A G 5: 146,583,635 V159A probably benign Het
Heatr5a A T 12: 51,910,101 probably benign Het
Helz2 A G 2: 181,232,116 I2195T probably damaging Het
Hikeshi A T 7: 89,920,087 N76K possibly damaging Het
Hsd11b1 T C 1: 193,229,676 probably benign Het
Inhba A T 13: 16,026,820 K322N probably damaging Het
Katnal1 A T 5: 148,892,516 F291L probably damaging Het
Kcnj9 T C 1: 172,323,098 E316G probably damaging Het
Lrsam1 A G 2: 32,933,923 probably benign Het
Mcf2l T G 8: 13,018,751 S1075A probably benign Het
Mios T C 6: 8,215,470 V222A possibly damaging Het
Mycbp2 A T 14: 103,196,391 probably benign Het
Nars A T 18: 64,500,567 I544N probably damaging Het
Olfr993 A G 2: 85,414,690 L63P possibly damaging Het
Pbrm1 A G 14: 31,046,430 probably benign Het
Plcb4 A G 2: 135,955,012 probably benign Het
Pnliprp1 A G 19: 58,734,706 D213G probably damaging Het
Psap A G 10: 60,300,855 N538D possibly damaging Het
Ptdss1 A G 13: 66,972,650 probably benign Het
Rap1b G A 10: 117,818,617 probably benign Het
Rhcg T A 7: 79,594,772 probably benign Het
Ryr1 G A 7: 29,104,795 T550I possibly damaging Het
Samm50 G A 15: 84,211,168 G452R probably benign Het
Scin A G 12: 40,080,930 probably null Het
Sesn3 T C 9: 14,308,558 L81S probably damaging Het
Skint6 A C 4: 112,858,169 probably benign Het
Slc30a4 A T 2: 122,685,240 L411H probably damaging Het
Slc44a5 C T 3: 154,234,145 probably benign Het
Slc4a3 C T 1: 75,549,021 A255V probably damaging Het
Slc9b1 A G 3: 135,382,832 N318S possibly damaging Het
Tcp11l2 A T 10: 84,604,594 H287L probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tnks2 T A 19: 36,872,562 Y605N probably damaging Het
Topbp1 T A 9: 103,349,838 N1490K probably benign Het
Ube4b T G 4: 149,357,577 probably benign Het
Usp4 G A 9: 108,348,029 probably benign Het
Vezf1 A T 11: 88,068,435 probably benign Het
Vmn1r184 A T 7: 26,267,075 D82V probably damaging Het
Other mutations in Dgkd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01529:Dgkd APN 1 87880411 missense probably damaging 1.00
IGL01531:Dgkd APN 1 87880411 missense probably damaging 1.00
IGL01627:Dgkd APN 1 87880428 missense probably damaging 1.00
IGL01720:Dgkd APN 1 87936765 missense probably damaging 1.00
IGL01915:Dgkd APN 1 87926058 missense possibly damaging 0.86
IGL01941:Dgkd APN 1 87924559 missense probably damaging 0.99
IGL01951:Dgkd APN 1 87916916 missense probably damaging 1.00
IGL02244:Dgkd APN 1 87915141 missense probably benign 0.27
IGL02581:Dgkd APN 1 87918002 splice site probably benign
IGL02852:Dgkd APN 1 87935413 missense probably damaging 1.00
IGL02893:Dgkd APN 1 87915208 splice site probably benign
IGL03367:Dgkd APN 1 87940308 critical splice donor site probably null
R0014:Dgkd UTSW 1 87881881 missense probably damaging 1.00
R0016:Dgkd UTSW 1 87917952 missense probably benign 0.02
R0219:Dgkd UTSW 1 87938274 splice site probably benign
R0496:Dgkd UTSW 1 87936900 missense probably null 0.83
R0559:Dgkd UTSW 1 87915104 missense probably damaging 1.00
R1270:Dgkd UTSW 1 87934125 missense probably damaging 0.96
R1599:Dgkd UTSW 1 87881886 missense possibly damaging 0.58
R1658:Dgkd UTSW 1 87926268 missense probably damaging 1.00
R1745:Dgkd UTSW 1 87932044 critical splice donor site probably null
R1959:Dgkd UTSW 1 87929827 missense possibly damaging 0.47
R1960:Dgkd UTSW 1 87929827 missense possibly damaging 0.47
R2044:Dgkd UTSW 1 87927691 missense probably benign
R2148:Dgkd UTSW 1 87881921 missense probably damaging 1.00
R2232:Dgkd UTSW 1 87929742 missense probably benign 0.05
R2266:Dgkd UTSW 1 87927818 unclassified probably benign
R3774:Dgkd UTSW 1 87936300 missense probably damaging 1.00
R4004:Dgkd UTSW 1 87935423 missense possibly damaging 0.56
R4005:Dgkd UTSW 1 87935423 missense possibly damaging 0.56
R4133:Dgkd UTSW 1 87941501 critical splice donor site probably null
R4235:Dgkd UTSW 1 87931982 nonsense probably null
R4644:Dgkd UTSW 1 87936294 missense probably damaging 1.00
R4747:Dgkd UTSW 1 87934167 missense probably damaging 1.00
R4864:Dgkd UTSW 1 87916838 missense possibly damaging 0.94
R5334:Dgkd UTSW 1 87938267 critical splice donor site probably null
R5365:Dgkd UTSW 1 87935416 missense probably damaging 1.00
R5495:Dgkd UTSW 1 87926872 missense probably damaging 1.00
R5514:Dgkd UTSW 1 87934110 missense probably damaging 1.00
R5729:Dgkd UTSW 1 87936332 nonsense probably null
R5766:Dgkd UTSW 1 87880449 nonsense probably null
R6133:Dgkd UTSW 1 87938240 missense possibly damaging 0.93
R6137:Dgkd UTSW 1 87936381 missense possibly damaging 0.48
R6198:Dgkd UTSW 1 87924208 missense probably damaging 1.00
R6297:Dgkd UTSW 1 87926144 missense possibly damaging 0.94
R6577:Dgkd UTSW 1 87940240 missense probably damaging 1.00
R6846:Dgkd UTSW 1 87925691 splice site probably null
R6905:Dgkd UTSW 1 87935375 missense probably damaging 1.00
R7369:Dgkd UTSW 1 87921622 missense probably damaging 1.00
R7763:Dgkd UTSW 1 87926949 missense probably benign
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ccaaaggcaaacaggagaag -3'
Posted On2013-07-11