Incidental Mutation 'R7190:Gatad2b'
ID559530
Institutional Source Beutler Lab
Gene Symbol Gatad2b
Ensembl Gene ENSMUSG00000042390
Gene NameGATA zinc finger domain containing 2B
Synonymsp66beta, C430014D17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7190 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location90293178-90363407 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 90350415 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 210 (I210N)
Ref Sequence ENSEMBL: ENSMUSP00000041370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049382] [ENSMUST00000197988] [ENSMUST00000199607] [ENSMUST00000199754]
Predicted Effect probably benign
Transcript: ENSMUST00000049382
AA Change: I210N

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000041370
Gene: ENSMUSG00000042390
AA Change: I210N

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
Pfam:P66_CC 158 201 1.7e-21 PFAM
low complexity region 341 361 N/A INTRINSIC
low complexity region 365 382 N/A INTRINSIC
Pfam:GATA 421 455 1e-11 PFAM
coiled coil region 456 478 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197988
AA Change: I210N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000143085
Gene: ENSMUSG00000042390
AA Change: I210N

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
coiled coil region 158 194 N/A INTRINSIC
low complexity region 325 345 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
Pfam:GATA 405 439 9.3e-11 PFAM
coiled coil region 440 462 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199607
AA Change: I210N

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000142617
Gene: ENSMUSG00000042390
AA Change: I210N

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
coiled coil region 158 194 N/A INTRINSIC
low complexity region 341 361 N/A INTRINSIC
low complexity region 365 382 N/A INTRINSIC
Pfam:GATA 421 455 7.8e-11 PFAM
coiled coil region 456 478 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199754
AA Change: I210N

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000142514
Gene: ENSMUSG00000042390
AA Change: I210N

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
coiled coil region 158 194 N/A INTRINSIC
low complexity region 341 361 N/A INTRINSIC
low complexity region 365 382 N/A INTRINSIC
Pfam:GATA 421 455 7.8e-11 PFAM
coiled coil region 456 478 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206907
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein transcriptional repressor. The encoded protein is part of the methyl-CpG-binding protein-1 complex, which represses gene expression by deacetylating methylated nucleosomes. Mutations in this gene are linked to intellectual disability and dysmorphic features associated with mental retardation. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add3 C T 19: 53,216,899 R27* probably null Het
Armc3 T A 2: 19,293,136 Y573N probably damaging Het
BC024978 G A 7: 27,201,123 A176T probably damaging Het
Bod1l A C 5: 41,819,938 N1344K probably benign Het
Camta1 T G 4: 151,148,523 N231T possibly damaging Het
Capza2 T A 6: 17,654,121 Y57* probably null Het
Ccdc186 T A 19: 56,792,000 I871F probably damaging Het
Cntnap5b A G 1: 100,431,849 probably null Het
Dnah2 G T 11: 69,549,097 probably null Het
Fhod3 T C 18: 25,090,755 F1053L probably damaging Het
Foxj1 A G 11: 116,332,375 Y201H possibly damaging Het
Gba T A 3: 89,204,362 I112N probably damaging Het
Gbp2 T C 3: 142,633,447 V420A probably benign Het
Gm3106 T G 5: 94,218,237 N71K probably benign Het
Gm8251 A C 1: 44,061,615 S108A probably benign Het
Golga3 T A 5: 110,209,855 H1072Q probably damaging Het
Gpr150 C T 13: 76,055,873 A318T probably benign Het
Gpr6 T C 10: 41,070,960 N209D probably damaging Het
Grin2b T C 6: 135,732,948 N1200S possibly damaging Het
Ifi207 G A 1: 173,730,252 H307Y unknown Het
Il20ra A T 10: 19,742,941 I46F probably damaging Het
Lvrn A G 18: 46,900,503 D927G probably benign Het
Nlrc4 G T 17: 74,445,203 D728E probably damaging Het
Nup107 T C 10: 117,762,135 D630G probably benign Het
Olfr378 A T 11: 73,425,164 I273N probably benign Het
Olfr787 T C 10: 129,462,757 I27T probably benign Het
Pclo C A 5: 14,679,729 A2867D unknown Het
Perm1 A G 4: 156,219,815 T754A possibly damaging Het
Plpbp G T 8: 27,051,297 V162L probably benign Het
Plscr4 A T 9: 92,488,641 E220D probably benign Het
Ppp2r3a A T 9: 101,212,527 M199K probably benign Het
Rassf6 T C 5: 90,606,807 E204G probably damaging Het
Reln A C 5: 22,047,947 D667E probably damaging Het
Rere A G 4: 150,610,953 I462V unknown Het
Rpain A G 11: 70,971,909 E76G possibly damaging Het
Strc T G 2: 121,369,026 I1311L probably benign Het
Svil A G 18: 5,092,937 M1385V probably benign Het
Syne2 T A 12: 76,066,587 D1083E probably benign Het
Szt2 T A 4: 118,389,006 H986L probably damaging Het
Tcl1b2 G T 12: 105,147,234 probably null Het
Thy1 T A 9: 44,046,925 S117T possibly damaging Het
Tmem183a A T 1: 134,354,758 I203N probably damaging Het
Tmprss11g T C 5: 86,496,632 I118V probably benign Het
Tsen34 T C 7: 3,694,807 V69A possibly damaging Het
Ttn T C 2: 76,886,799 Q7506R unknown Het
Vmn1r184 T C 7: 26,267,680 S284P probably damaging Het
Wdr19 A G 5: 65,240,862 D810G probably benign Het
Zer1 T C 2: 30,103,432 D554G probably damaging Het
Zfp626 A T 7: 27,818,343 T250S probably benign Het
Other mutations in Gatad2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01490:Gatad2b APN 3 90352078 missense possibly damaging 0.93
IGL02172:Gatad2b APN 3 90355671 splice site probably benign
IGL02672:Gatad2b APN 3 90341891 missense possibly damaging 0.77
IGL03030:Gatad2b APN 3 90341937 missense probably benign 0.11
FR4449:Gatad2b UTSW 3 90341917 small deletion probably benign
R0083:Gatad2b UTSW 3 90357943 missense probably damaging 1.00
R0108:Gatad2b UTSW 3 90357943 missense probably damaging 1.00
R0335:Gatad2b UTSW 3 90356182 missense probably benign 0.00
R0707:Gatad2b UTSW 3 90356182 missense probably benign 0.00
R1722:Gatad2b UTSW 3 90355679 missense probably damaging 1.00
R1782:Gatad2b UTSW 3 90341871 missense probably benign 0.01
R2138:Gatad2b UTSW 3 90352113 missense probably damaging 1.00
R5954:Gatad2b UTSW 3 90351441 missense probably damaging 1.00
R6834:Gatad2b UTSW 3 90348643 missense probably benign 0.00
R7104:Gatad2b UTSW 3 90351417 missense probably damaging 1.00
R7291:Gatad2b UTSW 3 90351414 missense probably damaging 0.99
R7760:Gatad2b UTSW 3 90354469 missense probably damaging 1.00
R7786:Gatad2b UTSW 3 90355679 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACTTAACTGAATTTGACCTCTAGGG -3'
(R):5'- AATGCTGATTAGTGGCTACAAAG -3'

Sequencing Primer
(F):5'- CCTCTAGGGTTTTTGGCTTAGG -3'
(R):5'- ATGCATGTGAATGCCATGCC -3'
Posted On2019-06-26