Incidental Mutation 'R7190:Gbp2'
ID559531
Institutional Source Beutler Lab
Gene Symbol Gbp2
Ensembl Gene ENSMUSG00000028270
Gene Nameguanylate binding protein 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7190 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location142620602-142638008 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 142633447 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 420 (V420A)
Ref Sequence ENSEMBL: ENSMUSP00000132435 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165774] [ENSMUST00000169572]
Predicted Effect probably benign
Transcript: ENSMUST00000165774
AA Change: V420A

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000132435
Gene: ENSMUSG00000028270
AA Change: V420A

DomainStartEndE-ValueType
Pfam:GBP 18 280 7.5e-124 PFAM
Pfam:GBP_C 282 578 1.3e-120 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169572
SMART Domains Protein: ENSMUSP00000129039
Gene: ENSMUSG00000028270

DomainStartEndE-ValueType
Pfam:GBP 18 115 3.1e-49 PFAM
Pfam:MMR_HSR1 40 116 1.3e-6 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the guanine-binding protein (GBP) family, which includes interferon-induced proteins that can bind to guanine nucleotides (GMP, GDP and GTP). The encoded protein is a GTPase which hydrolyzes GTP, predominantly to GDP. The protein may play a role as a marker of squamous cell carcinomas. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous inactivation of this gene leads to increased susceptibility to chronic Toxoplasma gondii infection, characterized by an increased parasite burden in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add3 C T 19: 53,216,899 R27* probably null Het
Armc3 T A 2: 19,293,136 Y573N probably damaging Het
BC024978 G A 7: 27,201,123 A176T probably damaging Het
Bod1l A C 5: 41,819,938 N1344K probably benign Het
Camta1 T G 4: 151,148,523 N231T possibly damaging Het
Capza2 T A 6: 17,654,121 Y57* probably null Het
Ccdc186 T A 19: 56,792,000 I871F probably damaging Het
Cntnap5b A G 1: 100,431,849 probably null Het
Dnah2 G T 11: 69,549,097 probably null Het
Fhod3 T C 18: 25,090,755 F1053L probably damaging Het
Foxj1 A G 11: 116,332,375 Y201H possibly damaging Het
Gatad2b T A 3: 90,350,415 I210N probably benign Het
Gba T A 3: 89,204,362 I112N probably damaging Het
Gm3106 T G 5: 94,218,237 N71K probably benign Het
Gm8251 A C 1: 44,061,615 S108A probably benign Het
Golga3 T A 5: 110,209,855 H1072Q probably damaging Het
Gpr150 C T 13: 76,055,873 A318T probably benign Het
Gpr6 T C 10: 41,070,960 N209D probably damaging Het
Grin2b T C 6: 135,732,948 N1200S possibly damaging Het
Ifi207 G A 1: 173,730,252 H307Y unknown Het
Il20ra A T 10: 19,742,941 I46F probably damaging Het
Lvrn A G 18: 46,900,503 D927G probably benign Het
Nlrc4 G T 17: 74,445,203 D728E probably damaging Het
Nup107 T C 10: 117,762,135 D630G probably benign Het
Olfr378 A T 11: 73,425,164 I273N probably benign Het
Olfr787 T C 10: 129,462,757 I27T probably benign Het
Pclo C A 5: 14,679,729 A2867D unknown Het
Perm1 A G 4: 156,219,815 T754A possibly damaging Het
Plpbp G T 8: 27,051,297 V162L probably benign Het
Plscr4 A T 9: 92,488,641 E220D probably benign Het
Ppp2r3a A T 9: 101,212,527 M199K probably benign Het
Rassf6 T C 5: 90,606,807 E204G probably damaging Het
Reln A C 5: 22,047,947 D667E probably damaging Het
Rere A G 4: 150,610,953 I462V unknown Het
Rpain A G 11: 70,971,909 E76G possibly damaging Het
Strc T G 2: 121,369,026 I1311L probably benign Het
Svil A G 18: 5,092,937 M1385V probably benign Het
Syne2 T A 12: 76,066,587 D1083E probably benign Het
Szt2 T A 4: 118,389,006 H986L probably damaging Het
Tcl1b2 G T 12: 105,147,234 probably null Het
Thy1 T A 9: 44,046,925 S117T possibly damaging Het
Tmem183a A T 1: 134,354,758 I203N probably damaging Het
Tmprss11g T C 5: 86,496,632 I118V probably benign Het
Tsen34 T C 7: 3,694,807 V69A possibly damaging Het
Ttn T C 2: 76,886,799 Q7506R unknown Het
Vmn1r184 T C 7: 26,267,680 S284P probably damaging Het
Wdr19 A G 5: 65,240,862 D810G probably benign Het
Zer1 T C 2: 30,103,432 D554G probably damaging Het
Zfp626 A T 7: 27,818,343 T250S probably benign Het
Other mutations in Gbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02026:Gbp2 APN 3 142633480 missense probably damaging 1.00
IGL02055:Gbp2 APN 3 142632230 missense probably benign 0.16
IGL03024:Gbp2 APN 3 142632019 missense probably damaging 1.00
P4717OSA:Gbp2 UTSW 3 142630596 missense possibly damaging 0.63
PIT4445001:Gbp2 UTSW 3 142637466 missense probably benign
R0267:Gbp2 UTSW 3 142630106 missense probably benign 0.00
R0507:Gbp2 UTSW 3 142630033 missense probably damaging 1.00
R0601:Gbp2 UTSW 3 142630758 missense possibly damaging 0.47
R1005:Gbp2 UTSW 3 142630501 splice site probably benign
R1006:Gbp2 UTSW 3 142637422 missense probably damaging 1.00
R1795:Gbp2 UTSW 3 142630523 missense possibly damaging 0.61
R1893:Gbp2 UTSW 3 142630172 splice site probably benign
R2398:Gbp2 UTSW 3 142633362 missense probably benign 0.01
R3978:Gbp2 UTSW 3 142629986 missense possibly damaging 0.88
R4095:Gbp2 UTSW 3 142637449 missense probably benign
R4490:Gbp2 UTSW 3 142623764 missense probably benign 0.30
R5799:Gbp2 UTSW 3 142632082 missense probably benign
R5834:Gbp2 UTSW 3 142633377 missense probably damaging 0.98
R6159:Gbp2 UTSW 3 142632257 missense probably damaging 0.99
R6237:Gbp2 UTSW 3 142632032 missense probably benign
R6494:Gbp2 UTSW 3 142632008 missense probably damaging 0.98
R6982:Gbp2 UTSW 3 142630085 missense probably damaging 1.00
Z1088:Gbp2 UTSW 3 142630015 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAGATTCTATAGCCAGCACCC -3'
(R):5'- CTCACTGGCATCTGGAAGAG -3'

Sequencing Primer
(F):5'- ATGAAGAGCCTGTCCCCATTTAG -3'
(R):5'- ACTGGCATCTGGAAGAGATTCCTC -3'
Posted On2019-06-26