Incidental Mutation 'R7190:Rere'
ID559533
Institutional Source Beutler Lab
Gene Symbol Rere
Ensembl Gene ENSMUSG00000039852
Gene Namearginine glutamic acid dipeptide (RE) repeats
Synonyms1110033A15Rik, eyes3, Atr2, eye, atrophin-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7190 (G1)
Quality Score183.009
Status Validated
Chromosome4
Chromosomal Location150281646-150621966 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 150610953 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 462 (I462V)
Ref Sequence ENSEMBL: ENSMUSP00000101307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105680] [ENSMUST00000105682]
Predicted Effect unknown
Transcript: ENSMUST00000105680
AA Change: I194V
SMART Domains Protein: ENSMUSP00000101305
Gene: ENSMUSG00000039852
AA Change: I194V

DomainStartEndE-ValueType
ELM2 18 70 1.67e-13 SMART
SANT 124 173 1.8e-6 SMART
low complexity region 176 193 N/A INTRINSIC
ZnF_GATA 233 284 1.94e-15 SMART
Pfam:Atrophin-1 300 1290 N/A PFAM
Predicted Effect unknown
Transcript: ENSMUST00000105682
AA Change: I462V
SMART Domains Protein: ENSMUSP00000101307
Gene: ENSMUSG00000039852
AA Change: I462V

DomainStartEndE-ValueType
low complexity region 3 31 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
low complexity region 73 85 N/A INTRINSIC
BAH 103 283 3.52e-13 SMART
ELM2 286 338 1.67e-13 SMART
SANT 392 441 1.8e-6 SMART
low complexity region 444 461 N/A INTRINSIC
ZnF_GATA 501 552 1.94e-15 SMART
Pfam:Atrophin-1 568 1557 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000219467
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the atrophin family of arginine-glutamic acid (RE) dipeptide repeat-containing proteins. The encoded protein co-localizes with a transcription factor in the nucleus, and its overexpression triggers apoptosis. A similar protein in mouse associates with histone deacetylase and is thought to function as a transcriptional co-repressor during embryonic development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality with abnormalities in neural tube development, somite development, and in the embryonic heart. Mice homozygous for an ENU-induced allele exhibit narrow snouts, decreased body weight, renal agenesis and small eyes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add3 C T 19: 53,216,899 R27* probably null Het
Armc3 T A 2: 19,293,136 Y573N probably damaging Het
BC024978 G A 7: 27,201,123 A176T probably damaging Het
Bod1l A C 5: 41,819,938 N1344K probably benign Het
Camta1 T G 4: 151,148,523 N231T possibly damaging Het
Capza2 T A 6: 17,654,121 Y57* probably null Het
Ccdc186 T A 19: 56,792,000 I871F probably damaging Het
Cntnap5b A G 1: 100,431,849 probably null Het
Dnah2 G T 11: 69,549,097 probably null Het
Fhod3 T C 18: 25,090,755 F1053L probably damaging Het
Foxj1 A G 11: 116,332,375 Y201H possibly damaging Het
Gatad2b T A 3: 90,350,415 I210N probably benign Het
Gba T A 3: 89,204,362 I112N probably damaging Het
Gbp2 T C 3: 142,633,447 V420A probably benign Het
Gm3106 T G 5: 94,218,237 N71K probably benign Het
Gm8251 A C 1: 44,061,615 S108A probably benign Het
Golga3 T A 5: 110,209,855 H1072Q probably damaging Het
Gpr150 C T 13: 76,055,873 A318T probably benign Het
Gpr6 T C 10: 41,070,960 N209D probably damaging Het
Grin2b T C 6: 135,732,948 N1200S possibly damaging Het
Ifi207 G A 1: 173,730,252 H307Y unknown Het
Il20ra A T 10: 19,742,941 I46F probably damaging Het
Lvrn A G 18: 46,900,503 D927G probably benign Het
Nlrc4 G T 17: 74,445,203 D728E probably damaging Het
Nup107 T C 10: 117,762,135 D630G probably benign Het
Olfr378 A T 11: 73,425,164 I273N probably benign Het
Olfr787 T C 10: 129,462,757 I27T probably benign Het
Pclo C A 5: 14,679,729 A2867D unknown Het
Perm1 A G 4: 156,219,815 T754A possibly damaging Het
Plpbp G T 8: 27,051,297 V162L probably benign Het
Plscr4 A T 9: 92,488,641 E220D probably benign Het
Ppp2r3a A T 9: 101,212,527 M199K probably benign Het
Rassf6 T C 5: 90,606,807 E204G probably damaging Het
Reln A C 5: 22,047,947 D667E probably damaging Het
Rpain A G 11: 70,971,909 E76G possibly damaging Het
Strc T G 2: 121,369,026 I1311L probably benign Het
Svil A G 18: 5,092,937 M1385V probably benign Het
Syne2 T A 12: 76,066,587 D1083E probably benign Het
Szt2 T A 4: 118,389,006 H986L probably damaging Het
Tcl1b2 G T 12: 105,147,234 probably null Het
Thy1 T A 9: 44,046,925 S117T possibly damaging Het
Tmem183a A T 1: 134,354,758 I203N probably damaging Het
Tmprss11g T C 5: 86,496,632 I118V probably benign Het
Tsen34 T C 7: 3,694,807 V69A possibly damaging Het
Ttn T C 2: 76,886,799 Q7506R unknown Het
Vmn1r184 T C 7: 26,267,680 S284P probably damaging Het
Wdr19 A G 5: 65,240,862 D810G probably benign Het
Zer1 T C 2: 30,103,432 D554G probably damaging Het
Zfp626 A T 7: 27,818,343 T250S probably benign Het
Other mutations in Rere
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Rere APN 4 150619463 missense probably damaging 1.00
IGL01465:Rere APN 4 150509994 missense unknown
IGL01523:Rere APN 4 150615555 missense possibly damaging 0.93
IGL01688:Rere APN 4 150618436 missense probably damaging 1.00
IGL02057:Rere APN 4 150614832 unclassified probably benign
IGL02621:Rere APN 4 150613812 unclassified probably benign
IGL02672:Rere APN 4 150510026 missense unknown
R0116:Rere UTSW 4 150616976 missense probably benign 0.18
R0119:Rere UTSW 4 150615322 unclassified probably benign
R0344:Rere UTSW 4 150610981 unclassified probably benign
R0504:Rere UTSW 4 150615322 unclassified probably benign
R0630:Rere UTSW 4 150619088 missense probably damaging 1.00
R0961:Rere UTSW 4 150615372 unclassified probably benign
R1164:Rere UTSW 4 150534884 missense unknown
R1424:Rere UTSW 4 150617038 missense probably damaging 1.00
R1542:Rere UTSW 4 150615942 missense probably damaging 1.00
R1652:Rere UTSW 4 150612065 unclassified probably benign
R1953:Rere UTSW 4 150616837 missense probably damaging 1.00
R1959:Rere UTSW 4 150468790 missense probably benign 0.23
R1966:Rere UTSW 4 150616873 missense probably damaging 1.00
R1975:Rere UTSW 4 150615733 missense probably damaging 0.99
R2070:Rere UTSW 4 150614590 unclassified probably benign
R2115:Rere UTSW 4 150612561 unclassified probably benign
R2144:Rere UTSW 4 150616931 missense probably damaging 0.99
R2270:Rere UTSW 4 150477380 missense unknown
R2969:Rere UTSW 4 150570216 missense unknown
R3699:Rere UTSW 4 150477362 critical splice acceptor site probably null
R3723:Rere UTSW 4 150468795 missense probably damaging 1.00
R3826:Rere UTSW 4 150470328 missense probably benign 0.42
R4234:Rere UTSW 4 150617405 missense probably damaging 1.00
R4512:Rere UTSW 4 150477452 missense unknown
R4798:Rere UTSW 4 150615167 unclassified probably benign
R4883:Rere UTSW 4 150616053 missense probably damaging 0.98
R4914:Rere UTSW 4 150619144 missense probably damaging 1.00
R4916:Rere UTSW 4 150619144 missense probably damaging 1.00
R4917:Rere UTSW 4 150619144 missense probably damaging 1.00
R4918:Rere UTSW 4 150619144 missense probably damaging 1.00
R4966:Rere UTSW 4 150613816 unclassified probably benign
R5172:Rere UTSW 4 150570269 missense unknown
R5643:Rere UTSW 4 150617243 missense probably damaging 1.00
R6058:Rere UTSW 4 150468798 missense probably damaging 1.00
R7112:Rere UTSW 4 150406604 missense probably benign
R7173:Rere UTSW 4 150468738 missense probably damaging 1.00
R8070:Rere UTSW 4 150617375 missense probably damaging 1.00
Z1176:Rere UTSW 4 150468783 missense probably damaging 1.00
Z1177:Rere UTSW 4 150615811 missense
Predicted Primers PCR Primer
(F):5'- TCACTCTGGAACACTGCTG -3'
(R):5'- CTCCCACAATTGTCAGTTGTCAG -3'

Sequencing Primer
(F):5'- AACACTGCTGCCCCCTG -3'
(R):5'- TTGTCAGTTGTCAGCACTAATATAC -3'
Posted On2019-06-26