Incidental Mutation 'R0591:Kcnj9'
ID55954
Institutional Source Beutler Lab
Gene Symbol Kcnj9
Ensembl Gene ENSMUSG00000038026
Gene Namepotassium inwardly-rectifying channel, subfamily J, member 9
SynonymsKir3.3, 1700085N21Rik, Girk3
MMRRC Submission 038781-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0591 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location172320501-172329318 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 172323098 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 316 (E316G)
Ref Sequence ENSEMBL: ENSMUSP00000141633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039506] [ENSMUST00000062387] [ENSMUST00000085912] [ENSMUST00000139528] [ENSMUST00000194204] [ENSMUST00000195659]
Predicted Effect probably benign
Transcript: ENSMUST00000039506
SMART Domains Protein: ENSMUSP00000041232
Gene: ENSMUSG00000038034

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 32 147 1.38e-6 SMART
low complexity region 155 166 N/A INTRINSIC
IG 169 285 2.3e-3 SMART
IG 309 433 9.49e-5 SMART
IG 445 571 3.59e-5 SMART
transmembrane domain 578 600 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000062387
AA Change: E316G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000060110
Gene: ENSMUSG00000038026
AA Change: E316G

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
Pfam:IRK 25 350 3.1e-142 PFAM
low complexity region 362 377 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085912
SMART Domains Protein: ENSMUSP00000083076
Gene: ENSMUSG00000038034

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
IG 32 147 1.38e-6 SMART
low complexity region 155 166 N/A INTRINSIC
IG 169 285 2.3e-3 SMART
IG 309 433 9.49e-5 SMART
IG 445 571 3.59e-5 SMART
transmembrane domain 578 600 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139528
SMART Domains Protein: ENSMUSP00000134280
Gene: ENSMUSG00000038034

DomainStartEndE-ValueType
IG_like 19 84 3.66e1 SMART
low complexity region 92 103 N/A INTRINSIC
IG 106 222 2.3e-3 SMART
IG 246 370 9.49e-5 SMART
IG 382 508 3.59e-5 SMART
transmembrane domain 515 537 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150598
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192957
Predicted Effect probably damaging
Transcript: ENSMUST00000194204
AA Change: E316G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141633
Gene: ENSMUSG00000038026
AA Change: E316G

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
Pfam:IRK 25 361 7.4e-165 PFAM
low complexity region 362 377 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194505
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194860
Predicted Effect probably benign
Transcript: ENSMUST00000195659
SMART Domains Protein: ENSMUSP00000141313
Gene: ENSMUSG00000038034

DomainStartEndE-ValueType
Blast:IG 1 67 2e-42 BLAST
SCOP:d1nkr_1 6 64 1e-3 SMART
transmembrane domain 74 96 N/A INTRINSIC
Meta Mutation Damage Score 0.1348 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.2%
  • 10x: 97.7%
  • 20x: 95.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which has a greater tendency to allow potassium to flow into a cell rather than out of a cell, is controlled by G-proteins. It associates with another G-protein-activated potassium channel to form a heteromultimeric pore-forming complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Inactivation of this locus does not result in any overt phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G T 3: 138,068,943 E1298* probably null Het
Adam19 T C 11: 46,121,411 probably benign Het
Agt A T 8: 124,556,939 S480R possibly damaging Het
Anapc1 G T 2: 128,619,332 D1769E probably benign Het
Aox4 T C 1: 58,239,102 probably benign Het
Apol9b G A 15: 77,735,630 V209I possibly damaging Het
Appl2 A T 10: 83,624,645 I116K possibly damaging Het
B230118H07Rik A T 2: 101,576,117 D155E probably benign Het
BC051665 A G 13: 60,784,608 probably benign Het
Cactin G T 10: 81,324,003 E89* probably null Het
Carf G T 1: 60,125,914 probably benign Het
Ccdc167 A G 17: 29,705,261 probably benign Het
Ceacam3 G A 7: 17,151,883 probably null Het
Clca4b T A 3: 144,915,592 K574* probably null Het
Crabp1 T A 9: 54,765,603 I64N probably damaging Het
Dgkd T A 1: 87,915,104 I118N probably damaging Het
Dglucy T C 12: 100,859,518 probably benign Het
Dock10 C T 1: 80,541,219 probably benign Het
Ednrb A T 14: 103,823,274 probably null Het
Ercc6 T C 14: 32,558,016 probably benign Het
Gm5538 C A 3: 59,752,129 Y334* probably null Het
Golga3 A C 5: 110,188,743 Q416P probably damaging Het
Gpr12 A G 5: 146,583,635 V159A probably benign Het
Heatr5a A T 12: 51,910,101 probably benign Het
Helz2 A G 2: 181,232,116 I2195T probably damaging Het
Hikeshi A T 7: 89,920,087 N76K possibly damaging Het
Hsd11b1 T C 1: 193,229,676 probably benign Het
Inhba A T 13: 16,026,820 K322N probably damaging Het
Katnal1 A T 5: 148,892,516 F291L probably damaging Het
Lrsam1 A G 2: 32,933,923 probably benign Het
Mcf2l T G 8: 13,018,751 S1075A probably benign Het
Mios T C 6: 8,215,470 V222A possibly damaging Het
Mycbp2 A T 14: 103,196,391 probably benign Het
Nars A T 18: 64,500,567 I544N probably damaging Het
Olfr993 A G 2: 85,414,690 L63P possibly damaging Het
Pbrm1 A G 14: 31,046,430 probably benign Het
Plcb4 A G 2: 135,955,012 probably benign Het
Pnliprp1 A G 19: 58,734,706 D213G probably damaging Het
Psap A G 10: 60,300,855 N538D possibly damaging Het
Ptdss1 A G 13: 66,972,650 probably benign Het
Rap1b G A 10: 117,818,617 probably benign Het
Rhcg T A 7: 79,594,772 probably benign Het
Ryr1 G A 7: 29,104,795 T550I possibly damaging Het
Samm50 G A 15: 84,211,168 G452R probably benign Het
Scin A G 12: 40,080,930 probably null Het
Sesn3 T C 9: 14,308,558 L81S probably damaging Het
Skint6 A C 4: 112,858,169 probably benign Het
Slc30a4 A T 2: 122,685,240 L411H probably damaging Het
Slc44a5 C T 3: 154,234,145 probably benign Het
Slc4a3 C T 1: 75,549,021 A255V probably damaging Het
Slc9b1 A G 3: 135,382,832 N318S possibly damaging Het
Tcp11l2 A T 10: 84,604,594 H287L probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tnks2 T A 19: 36,872,562 Y605N probably damaging Het
Topbp1 T A 9: 103,349,838 N1490K probably benign Het
Ube4b T G 4: 149,357,577 probably benign Het
Usp4 G A 9: 108,348,029 probably benign Het
Vezf1 A T 11: 88,068,435 probably benign Het
Vmn1r184 A T 7: 26,267,075 D82V probably damaging Het
Other mutations in Kcnj9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02094:Kcnj9 APN 1 172325708 missense probably damaging 1.00
IGL02616:Kcnj9 APN 1 172325964 missense probably damaging 1.00
R0131:Kcnj9 UTSW 1 172326198 missense probably damaging 0.99
R0131:Kcnj9 UTSW 1 172326198 missense probably damaging 0.99
R0132:Kcnj9 UTSW 1 172326198 missense probably damaging 0.99
R0505:Kcnj9 UTSW 1 172323024 missense probably benign 0.01
R0726:Kcnj9 UTSW 1 172325921 missense probably damaging 1.00
R1178:Kcnj9 UTSW 1 172322963 missense probably benign 0.00
R1485:Kcnj9 UTSW 1 172326362 missense probably benign 0.24
R1989:Kcnj9 UTSW 1 172326149 missense probably benign 0.05
R5165:Kcnj9 UTSW 1 172323157 missense probably benign 0.00
R6245:Kcnj9 UTSW 1 172326137 missense probably damaging 1.00
R6344:Kcnj9 UTSW 1 172326146 missense probably benign 0.01
R6903:Kcnj9 UTSW 1 172326056 missense probably damaging 1.00
R7309:Kcnj9 UTSW 1 172326258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCACACCTTGGACTCACTCTCTG -3'
(R):5'- TGGCACGTTGCACAAAGGACTG -3'

Sequencing Primer
(F):5'- AGGCAGCCATTGTGCTC -3'
(R):5'- GTGTAATCAGTTCAGCCCATTG -3'
Posted On2013-07-11