Incidental Mutation 'R7190:Tmprss11g'
ID559540
Institutional Source Beutler Lab
Gene Symbol Tmprss11g
Ensembl Gene ENSMUSG00000079451
Gene Nametransmembrane protease, serine 11g
SynonymsDesc4, 9930032O22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R7190 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location86485876-86518600 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86496632 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 118 (I118V)
Ref Sequence ENSEMBL: ENSMUSP00000122709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000134179] [ENSMUST00000140095]
Predicted Effect probably benign
Transcript: ENSMUST00000134179
AA Change: I118V

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000122709
Gene: ENSMUSG00000079451
AA Change: I118V

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:SEA 48 150 1.5e-25 PFAM
Tryp_SPc 185 411 1.39e-82 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140095
AA Change: I118V

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000115540
Gene: ENSMUSG00000079451
AA Change: I118V

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:SEA 45 154 1.3e-19 PFAM
Tryp_SPc 172 398 1.39e-82 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add3 C T 19: 53,216,899 R27* probably null Het
Armc3 T A 2: 19,293,136 Y573N probably damaging Het
BC024978 G A 7: 27,201,123 A176T probably damaging Het
Bod1l A C 5: 41,819,938 N1344K probably benign Het
Camta1 T G 4: 151,148,523 N231T possibly damaging Het
Capza2 T A 6: 17,654,121 Y57* probably null Het
Ccdc186 T A 19: 56,792,000 I871F probably damaging Het
Cntnap5b A G 1: 100,431,849 probably null Het
Dnah2 G T 11: 69,549,097 probably null Het
Fhod3 T C 18: 25,090,755 F1053L probably damaging Het
Foxj1 A G 11: 116,332,375 Y201H possibly damaging Het
Gatad2b T A 3: 90,350,415 I210N probably benign Het
Gba T A 3: 89,204,362 I112N probably damaging Het
Gbp2 T C 3: 142,633,447 V420A probably benign Het
Gm3106 T G 5: 94,218,237 N71K probably benign Het
Gm8251 A C 1: 44,061,615 S108A probably benign Het
Golga3 T A 5: 110,209,855 H1072Q probably damaging Het
Gpr150 C T 13: 76,055,873 A318T probably benign Het
Gpr6 T C 10: 41,070,960 N209D probably damaging Het
Grin2b T C 6: 135,732,948 N1200S possibly damaging Het
Ifi207 G A 1: 173,730,252 H307Y unknown Het
Il20ra A T 10: 19,742,941 I46F probably damaging Het
Lvrn A G 18: 46,900,503 D927G probably benign Het
Nlrc4 G T 17: 74,445,203 D728E probably damaging Het
Nup107 T C 10: 117,762,135 D630G probably benign Het
Olfr378 A T 11: 73,425,164 I273N probably benign Het
Olfr787 T C 10: 129,462,757 I27T probably benign Het
Pclo C A 5: 14,679,729 A2867D unknown Het
Perm1 A G 4: 156,219,815 T754A possibly damaging Het
Plpbp G T 8: 27,051,297 V162L probably benign Het
Plscr4 A T 9: 92,488,641 E220D probably benign Het
Ppp2r3a A T 9: 101,212,527 M199K probably benign Het
Rassf6 T C 5: 90,606,807 E204G probably damaging Het
Reln A C 5: 22,047,947 D667E probably damaging Het
Rere A G 4: 150,610,953 I462V unknown Het
Rpain A G 11: 70,971,909 E76G possibly damaging Het
Strc T G 2: 121,369,026 I1311L probably benign Het
Svil A G 18: 5,092,937 M1385V probably benign Het
Syne2 T A 12: 76,066,587 D1083E probably benign Het
Szt2 T A 4: 118,389,006 H986L probably damaging Het
Tcl1b2 G T 12: 105,147,234 probably null Het
Thy1 T A 9: 44,046,925 S117T possibly damaging Het
Tmem183a A T 1: 134,354,758 I203N probably damaging Het
Tsen34 T C 7: 3,694,807 V69A possibly damaging Het
Ttn T C 2: 76,886,799 Q7506R unknown Het
Vmn1r184 T C 7: 26,267,680 S284P probably damaging Het
Wdr19 A G 5: 65,240,862 D810G probably benign Het
Zer1 T C 2: 30,103,432 D554G probably damaging Het
Zfp626 A T 7: 27,818,343 T250S probably benign Het
Other mutations in Tmprss11g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Tmprss11g APN 5 86492191 missense probably benign 0.00
IGL01611:Tmprss11g APN 5 86490781 missense probably benign 0.02
IGL02417:Tmprss11g APN 5 86490891 missense probably benign 0.25
IGL02677:Tmprss11g APN 5 86492290 missense probably benign
IGL02832:Tmprss11g APN 5 86497269 missense probably benign 0.23
IGL02887:Tmprss11g APN 5 86497329 splice site probably benign
R0377:Tmprss11g UTSW 5 86490751 missense probably damaging 0.98
R0847:Tmprss11g UTSW 5 86490726 missense probably benign 0.01
R1037:Tmprss11g UTSW 5 86490747 missense probably damaging 1.00
R1507:Tmprss11g UTSW 5 86499611 missense probably benign 0.09
R1617:Tmprss11g UTSW 5 86499563 missense probably damaging 0.99
R1955:Tmprss11g UTSW 5 86498532 missense probably damaging 0.99
R2094:Tmprss11g UTSW 5 86499556 missense probably damaging 1.00
R2906:Tmprss11g UTSW 5 86492802 intron probably benign
R4730:Tmprss11g UTSW 5 86489232 nonsense probably null
R4730:Tmprss11g UTSW 5 86489233 missense probably damaging 1.00
R4934:Tmprss11g UTSW 5 86496542 missense probably benign
R4982:Tmprss11g UTSW 5 86492815 missense probably damaging 1.00
R5086:Tmprss11g UTSW 5 86496518 missense possibly damaging 0.65
R5606:Tmprss11g UTSW 5 86487410 missense probably damaging 1.00
R5825:Tmprss11g UTSW 5 86498533 missense probably damaging 0.98
R6291:Tmprss11g UTSW 5 86487422 missense probably damaging 1.00
R6481:Tmprss11g UTSW 5 86492156 missense probably benign 0.20
R6849:Tmprss11g UTSW 5 86496632 missense probably benign 0.01
R6925:Tmprss11g UTSW 5 86487426 missense probably benign 0.09
R6925:Tmprss11g UTSW 5 86487436 missense probably benign 0.00
R7084:Tmprss11g UTSW 5 86492200 missense probably damaging 1.00
R7089:Tmprss11g UTSW 5 86489291 missense probably damaging 0.97
R7352:Tmprss11g UTSW 5 86496542 missense not run
R7432:Tmprss11g UTSW 5 86496507 missense possibly damaging 0.71
R7514:Tmprss11g UTSW 5 86497317 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTACCTAGTGACTCCGGAGACC -3'
(R):5'- GACATATAAATGGGAAGCTCATGAC -3'

Sequencing Primer
(F):5'- GAGCTTTCTCCATAGACAGAAGGTTG -3'
(R):5'- TGGGAAGCTCATGACAATAAACTATG -3'
Posted On2019-06-26