Incidental Mutation 'R7190:Rassf6'
ID559541
Institutional Source Beutler Lab
Gene Symbol Rassf6
Ensembl Gene ENSMUSG00000029370
Gene NameRas association (RalGDS/AF-6) domain family member 6
Synonyms1600016B17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R7190 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location90603076-90640657 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90606807 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 204 (E204G)
Ref Sequence ENSEMBL: ENSMUSP00000144337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031317] [ENSMUST00000202704] [ENSMUST00000202784]
Predicted Effect probably damaging
Transcript: ENSMUST00000031317
AA Change: E217G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000031317
Gene: ENSMUSG00000029370
AA Change: E217G

DomainStartEndE-ValueType
RA 188 278 2.67e-9 SMART
Pfam:Nore1-SARAH 290 329 1.1e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000202704
AA Change: E217G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144532
Gene: ENSMUSG00000029370
AA Change: E217G

DomainStartEndE-ValueType
RA 188 278 2.67e-9 SMART
Pfam:Nore1-SARAH 290 329 1.1e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000202784
AA Change: E204G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144337
Gene: ENSMUSG00000029370
AA Change: E204G

DomainStartEndE-ValueType
low complexity region 126 135 N/A INTRINSIC
RA 175 265 2.67e-9 SMART
Pfam:Nore1-SARAH 277 316 8.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202807
Meta Mutation Damage Score 0.5970 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras-association domain family (RASSF). Members of this family form the core of a highly conserved tumor suppressor network, the Salvador-Warts-Hippo (SWH) pathway. The protein encoded by this gene is a Ras effector protein that induces apoptosis. A genomic region containing this gene has been linked to susceptibility to viral bronchiolitis. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add3 C T 19: 53,216,899 R27* probably null Het
Armc3 T A 2: 19,293,136 Y573N probably damaging Het
BC024978 G A 7: 27,201,123 A176T probably damaging Het
Bod1l A C 5: 41,819,938 N1344K probably benign Het
Camta1 T G 4: 151,148,523 N231T possibly damaging Het
Capza2 T A 6: 17,654,121 Y57* probably null Het
Ccdc186 T A 19: 56,792,000 I871F probably damaging Het
Cntnap5b A G 1: 100,431,849 probably null Het
Dnah2 G T 11: 69,549,097 probably null Het
Fhod3 T C 18: 25,090,755 F1053L probably damaging Het
Foxj1 A G 11: 116,332,375 Y201H possibly damaging Het
Gatad2b T A 3: 90,350,415 I210N probably benign Het
Gba T A 3: 89,204,362 I112N probably damaging Het
Gbp2 T C 3: 142,633,447 V420A probably benign Het
Gm3106 T G 5: 94,218,237 N71K probably benign Het
Gm8251 A C 1: 44,061,615 S108A probably benign Het
Golga3 T A 5: 110,209,855 H1072Q probably damaging Het
Gpr150 C T 13: 76,055,873 A318T probably benign Het
Gpr6 T C 10: 41,070,960 N209D probably damaging Het
Grin2b T C 6: 135,732,948 N1200S possibly damaging Het
Ifi207 G A 1: 173,730,252 H307Y unknown Het
Il20ra A T 10: 19,742,941 I46F probably damaging Het
Lvrn A G 18: 46,900,503 D927G probably benign Het
Nlrc4 G T 17: 74,445,203 D728E probably damaging Het
Nup107 T C 10: 117,762,135 D630G probably benign Het
Olfr378 A T 11: 73,425,164 I273N probably benign Het
Olfr787 T C 10: 129,462,757 I27T probably benign Het
Pclo C A 5: 14,679,729 A2867D unknown Het
Perm1 A G 4: 156,219,815 T754A possibly damaging Het
Plpbp G T 8: 27,051,297 V162L probably benign Het
Plscr4 A T 9: 92,488,641 E220D probably benign Het
Ppp2r3a A T 9: 101,212,527 M199K probably benign Het
Reln A C 5: 22,047,947 D667E probably damaging Het
Rere A G 4: 150,610,953 I462V unknown Het
Rpain A G 11: 70,971,909 E76G possibly damaging Het
Strc T G 2: 121,369,026 I1311L probably benign Het
Svil A G 18: 5,092,937 M1385V probably benign Het
Syne2 T A 12: 76,066,587 D1083E probably benign Het
Szt2 T A 4: 118,389,006 H986L probably damaging Het
Tcl1b2 G T 12: 105,147,234 probably null Het
Thy1 T A 9: 44,046,925 S117T possibly damaging Het
Tmem183a A T 1: 134,354,758 I203N probably damaging Het
Tmprss11g T C 5: 86,496,632 I118V probably benign Het
Tsen34 T C 7: 3,694,807 V69A possibly damaging Het
Ttn T C 2: 76,886,799 Q7506R unknown Het
Vmn1r184 T C 7: 26,267,680 S284P probably damaging Het
Wdr19 A G 5: 65,240,862 D810G probably benign Het
Zer1 T C 2: 30,103,432 D554G probably damaging Het
Zfp626 A T 7: 27,818,343 T250S probably benign Het
Other mutations in Rassf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Rassf6 APN 5 90604140 missense probably damaging 1.00
IGL00819:Rassf6 APN 5 90604071 missense probably benign 0.03
IGL01139:Rassf6 APN 5 90608966 makesense probably null
IGL03114:Rassf6 APN 5 90608790 splice site probably benign
R1956:Rassf6 UTSW 5 90615871 nonsense probably null
R2167:Rassf6 UTSW 5 90603938 missense probably damaging 1.00
R2351:Rassf6 UTSW 5 90631559 missense probably benign 0.05
R2877:Rassf6 UTSW 5 90606805 missense probably damaging 1.00
R3943:Rassf6 UTSW 5 90604326 missense possibly damaging 0.49
R3944:Rassf6 UTSW 5 90604326 missense possibly damaging 0.49
R4131:Rassf6 UTSW 5 90609787 missense probably damaging 1.00
R5134:Rassf6 UTSW 5 90604366 critical splice acceptor site probably null
R5153:Rassf6 UTSW 5 90606840 missense possibly damaging 0.81
R5633:Rassf6 UTSW 5 90604118 missense possibly damaging 0.84
R5994:Rassf6 UTSW 5 90617768 missense probably damaging 1.00
R6000:Rassf6 UTSW 5 90603877 missense probably damaging 1.00
R6746:Rassf6 UTSW 5 90609774 missense possibly damaging 0.80
R7038:Rassf6 UTSW 5 90609725 missense probably benign 0.13
R7549:Rassf6 UTSW 5 90606802 missense probably damaging 1.00
RF002:Rassf6 UTSW 5 90608921 utr 3 prime probably benign
RF002:Rassf6 UTSW 5 90608925 nonsense probably null
RF004:Rassf6 UTSW 5 90608919 utr 3 prime probably benign
RF011:Rassf6 UTSW 5 90608921 utr 3 prime probably benign
RF013:Rassf6 UTSW 5 90608941 utr 3 prime probably benign
RF018:Rassf6 UTSW 5 90608929 utr 3 prime probably benign
RF032:Rassf6 UTSW 5 90608939 utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90608912 utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90608917 utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90608923 utr 3 prime probably benign
RF035:Rassf6 UTSW 5 90608908 utr 3 prime probably benign
RF036:Rassf6 UTSW 5 90608915 utr 3 prime probably benign
RF038:Rassf6 UTSW 5 90608924 utr 3 prime probably benign
RF038:Rassf6 UTSW 5 90608930 utr 3 prime probably benign
RF039:Rassf6 UTSW 5 90608915 utr 3 prime probably benign
RF039:Rassf6 UTSW 5 90608939 utr 3 prime probably benign
RF043:Rassf6 UTSW 5 90608932 utr 3 prime probably benign
RF043:Rassf6 UTSW 5 90608939 utr 3 prime probably benign
RF049:Rassf6 UTSW 5 90608913 utr 3 prime probably benign
RF051:Rassf6 UTSW 5 90608929 utr 3 prime probably benign
RF052:Rassf6 UTSW 5 90608916 utr 3 prime probably benign
RF052:Rassf6 UTSW 5 90608923 utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90608911 utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90608924 utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90608931 utr 3 prime probably benign
RF063:Rassf6 UTSW 5 90608942 nonsense probably null
X0017:Rassf6 UTSW 5 90606789 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATGACATCTTCCCAGCTC -3'
(R):5'- AGGAGTTGCATCATCACTTCTTAG -3'

Sequencing Primer
(F):5'- TGGGCTACAGCTACCCCAAG -3'
(R):5'- ACTTCTTAGAATTACATCCCCCAC -3'
Posted On2019-06-26