Incidental Mutation 'R7190:Capza2'
ID559544
Institutional Source Beutler Lab
Gene Symbol Capza2
Ensembl Gene ENSMUSG00000015733
Gene Namecapping protein (actin filament) muscle Z-line, alpha 2
Synonyms1110053K06Rik, Cappa2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.404) question?
Stock #R7190 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location17636234-17666972 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 17654121 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 57 (Y57*)
Ref Sequence ENSEMBL: ENSMUSP00000015877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015877] [ENSMUST00000130606] [ENSMUST00000152005]
Predicted Effect probably null
Transcript: ENSMUST00000015877
AA Change: Y57*
SMART Domains Protein: ENSMUSP00000015877
Gene: ENSMUSG00000015733
AA Change: Y57*

DomainStartEndE-ValueType
Pfam:F-actin_cap_A 14 282 3.2e-109 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000130606
AA Change: Y57*
SMART Domains Protein: ENSMUSP00000123398
Gene: ENSMUSG00000015733
AA Change: Y57*

DomainStartEndE-ValueType
Pfam:F-actin_cap_A 12 173 1.3e-52 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000152005
AA Change: Y57*
SMART Domains Protein: ENSMUSP00000145159
Gene: ENSMUSG00000015733
AA Change: Y57*

DomainStartEndE-ValueType
Pfam:F-actin_cap_A 14 145 2.1e-42 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the F-actin capping protein alpha subunit family. It is the alpha subunit of the barbed-end actin binding protein Cap Z. By capping the barbed end of actin filaments, Cap Z regulates the growth of the actin filaments at the barbed end. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add3 C T 19: 53,216,899 R27* probably null Het
Armc3 T A 2: 19,293,136 Y573N probably damaging Het
BC024978 G A 7: 27,201,123 A176T probably damaging Het
Bod1l A C 5: 41,819,938 N1344K probably benign Het
Camta1 T G 4: 151,148,523 N231T possibly damaging Het
Ccdc186 T A 19: 56,792,000 I871F probably damaging Het
Cntnap5b A G 1: 100,431,849 probably null Het
Dnah2 G T 11: 69,549,097 probably null Het
Fhod3 T C 18: 25,090,755 F1053L probably damaging Het
Foxj1 A G 11: 116,332,375 Y201H possibly damaging Het
Gatad2b T A 3: 90,350,415 I210N probably benign Het
Gba T A 3: 89,204,362 I112N probably damaging Het
Gbp2 T C 3: 142,633,447 V420A probably benign Het
Gm3106 T G 5: 94,218,237 N71K probably benign Het
Gm8251 A C 1: 44,061,615 S108A probably benign Het
Golga3 T A 5: 110,209,855 H1072Q probably damaging Het
Gpr150 C T 13: 76,055,873 A318T probably benign Het
Gpr6 T C 10: 41,070,960 N209D probably damaging Het
Grin2b T C 6: 135,732,948 N1200S possibly damaging Het
Ifi207 G A 1: 173,730,252 H307Y unknown Het
Il20ra A T 10: 19,742,941 I46F probably damaging Het
Lvrn A G 18: 46,900,503 D927G probably benign Het
Nlrc4 G T 17: 74,445,203 D728E probably damaging Het
Nup107 T C 10: 117,762,135 D630G probably benign Het
Olfr378 A T 11: 73,425,164 I273N probably benign Het
Olfr787 T C 10: 129,462,757 I27T probably benign Het
Pclo C A 5: 14,679,729 A2867D unknown Het
Perm1 A G 4: 156,219,815 T754A possibly damaging Het
Plpbp G T 8: 27,051,297 V162L probably benign Het
Plscr4 A T 9: 92,488,641 E220D probably benign Het
Ppp2r3a A T 9: 101,212,527 M199K probably benign Het
Rassf6 T C 5: 90,606,807 E204G probably damaging Het
Reln A C 5: 22,047,947 D667E probably damaging Het
Rere A G 4: 150,610,953 I462V unknown Het
Rpain A G 11: 70,971,909 E76G possibly damaging Het
Strc T G 2: 121,369,026 I1311L probably benign Het
Svil A G 18: 5,092,937 M1385V probably benign Het
Syne2 T A 12: 76,066,587 D1083E probably benign Het
Szt2 T A 4: 118,389,006 H986L probably damaging Het
Tcl1b2 G T 12: 105,147,234 probably null Het
Thy1 T A 9: 44,046,925 S117T possibly damaging Het
Tmem183a A T 1: 134,354,758 I203N probably damaging Het
Tmprss11g T C 5: 86,496,632 I118V probably benign Het
Tsen34 T C 7: 3,694,807 V69A possibly damaging Het
Ttn T C 2: 76,886,799 Q7506R unknown Het
Vmn1r184 T C 7: 26,267,680 S284P probably damaging Het
Wdr19 A G 5: 65,240,862 D810G probably benign Het
Zer1 T C 2: 30,103,432 D554G probably damaging Het
Zfp626 A T 7: 27,818,343 T250S probably benign Het
Other mutations in Capza2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01115:Capza2 APN 6 17654123 missense probably damaging 1.00
IGL01330:Capza2 APN 6 17654171 critical splice donor site probably null
IGL02692:Capza2 APN 6 17654116 nonsense probably null
R0086:Capza2 UTSW 6 17660774 missense probably damaging 1.00
R0302:Capza2 UTSW 6 17648524 missense probably benign 0.01
R0331:Capza2 UTSW 6 17665103 missense probably benign 0.09
R1466:Capza2 UTSW 6 17657159 intron probably benign
R2036:Capza2 UTSW 6 17660778 missense probably damaging 1.00
R4395:Capza2 UTSW 6 17656450 splice site probably null
R4978:Capza2 UTSW 6 17662115 missense probably null 0.69
R5653:Capza2 UTSW 6 17654113 missense probably damaging 1.00
R5734:Capza2 UTSW 6 17660765 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCATGGCATGTATTTACTGG -3'
(R):5'- AACCACTACACCTGACTTTCTG -3'

Sequencing Primer
(F):5'- ATCATTACTTGGTTTTTAAAACAGCC -3'
(R):5'- ACTACACCTGACTTTCTGATACTAC -3'
Posted On2019-06-26