Incidental Mutation 'R7190:Zfp626'
ID559549
Institutional Source Beutler Lab
Gene Symbol Zfp626
Ensembl Gene ENSMUSG00000030604
Gene Namezinc finger protein 626
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R7190 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location27807196-27822916 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 27818343 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 250 (T250S)
Ref Sequence ENSEMBL: ENSMUSP00000146286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080175] [ENSMUST00000205671]
Predicted Effect probably benign
Transcript: ENSMUST00000080175
AA Change: T176S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000079068
Gene: ENSMUSG00000030604
AA Change: T176S

DomainStartEndE-ValueType
ZnF_C2H2 99 121 1.16e-1 SMART
ZnF_C2H2 127 149 8.98e0 SMART
ZnF_C2H2 155 177 5.42e-2 SMART
ZnF_C2H2 183 205 3.39e-3 SMART
ZnF_C2H2 211 233 3.69e-4 SMART
ZnF_C2H2 239 261 4.72e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205671
AA Change: T250S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add3 C T 19: 53,216,899 R27* probably null Het
Armc3 T A 2: 19,293,136 Y573N probably damaging Het
BC024978 G A 7: 27,201,123 A176T probably damaging Het
Bod1l A C 5: 41,819,938 N1344K probably benign Het
Camta1 T G 4: 151,148,523 N231T possibly damaging Het
Capza2 T A 6: 17,654,121 Y57* probably null Het
Ccdc186 T A 19: 56,792,000 I871F probably damaging Het
Cntnap5b A G 1: 100,431,849 probably null Het
Dnah2 G T 11: 69,549,097 probably null Het
Fhod3 T C 18: 25,090,755 F1053L probably damaging Het
Foxj1 A G 11: 116,332,375 Y201H possibly damaging Het
Gatad2b T A 3: 90,350,415 I210N probably benign Het
Gba T A 3: 89,204,362 I112N probably damaging Het
Gbp2 T C 3: 142,633,447 V420A probably benign Het
Gm3106 T G 5: 94,218,237 N71K probably benign Het
Gm8251 A C 1: 44,061,615 S108A probably benign Het
Golga3 T A 5: 110,209,855 H1072Q probably damaging Het
Gpr150 C T 13: 76,055,873 A318T probably benign Het
Gpr6 T C 10: 41,070,960 N209D probably damaging Het
Grin2b T C 6: 135,732,948 N1200S possibly damaging Het
Ifi207 G A 1: 173,730,252 H307Y unknown Het
Il20ra A T 10: 19,742,941 I46F probably damaging Het
Lvrn A G 18: 46,900,503 D927G probably benign Het
Nlrc4 G T 17: 74,445,203 D728E probably damaging Het
Nup107 T C 10: 117,762,135 D630G probably benign Het
Olfr378 A T 11: 73,425,164 I273N probably benign Het
Olfr787 T C 10: 129,462,757 I27T probably benign Het
Pclo C A 5: 14,679,729 A2867D unknown Het
Perm1 A G 4: 156,219,815 T754A possibly damaging Het
Plpbp G T 8: 27,051,297 V162L probably benign Het
Plscr4 A T 9: 92,488,641 E220D probably benign Het
Ppp2r3a A T 9: 101,212,527 M199K probably benign Het
Rassf6 T C 5: 90,606,807 E204G probably damaging Het
Reln A C 5: 22,047,947 D667E probably damaging Het
Rere A G 4: 150,610,953 I462V unknown Het
Rpain A G 11: 70,971,909 E76G possibly damaging Het
Strc T G 2: 121,369,026 I1311L probably benign Het
Svil A G 18: 5,092,937 M1385V probably benign Het
Syne2 T A 12: 76,066,587 D1083E probably benign Het
Szt2 T A 4: 118,389,006 H986L probably damaging Het
Tcl1b2 G T 12: 105,147,234 probably null Het
Thy1 T A 9: 44,046,925 S117T possibly damaging Het
Tmem183a A T 1: 134,354,758 I203N probably damaging Het
Tmprss11g T C 5: 86,496,632 I118V probably benign Het
Tsen34 T C 7: 3,694,807 V69A possibly damaging Het
Ttn T C 2: 76,886,799 Q7506R unknown Het
Vmn1r184 T C 7: 26,267,680 S284P probably damaging Het
Wdr19 A G 5: 65,240,862 D810G probably benign Het
Zer1 T C 2: 30,103,432 D554G probably damaging Het
Other mutations in Zfp626
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0726:Zfp626 UTSW 7 27818623 missense probably damaging 1.00
R0973:Zfp626 UTSW 7 27818482 missense probably damaging 0.97
R0973:Zfp626 UTSW 7 27818482 missense probably damaging 0.97
R0974:Zfp626 UTSW 7 27818482 missense probably damaging 0.97
R3085:Zfp626 UTSW 7 27818162 missense probably benign 0.12
R5421:Zfp626 UTSW 7 27817910 missense probably damaging 0.97
R6213:Zfp626 UTSW 7 27808292 missense probably benign 0.00
R6950:Zfp626 UTSW 7 27818914 missense probably damaging 1.00
R7359:Zfp626 UTSW 7 27808235 missense probably damaging 1.00
R7547:Zfp626 UTSW 7 27818403 missense possibly damaging 0.86
R7783:Zfp626 UTSW 7 27818370 missense possibly damaging 0.83
R7889:Zfp626 UTSW 7 27819499 missense probably benign 0.03
R7972:Zfp626 UTSW 7 27819499 missense probably benign 0.03
R8011:Zfp626 UTSW 7 27818715 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- ACAGTGTGGGAAGTGCTTC -3'
(R):5'- ACACTGAAAGGGTCTCTCACC -3'

Sequencing Primer
(F):5'- AGTCAGCATCAGAGTGTTCATGC -3'
(R):5'- GGTCTCTCACCAGAATGAATTTTC -3'
Posted On2019-06-26