Incidental Mutation 'R7190:Thy1'
ID559551
Institutional Source Beutler Lab
Gene Symbol Thy1
Ensembl Gene ENSMUSG00000032011
Gene Namethymus cell antigen 1, theta
SynonymsThy 1.2, Thy1.2, T25, Thy1.1, Thy-1, Thy-1.2, CD90
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7190 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location44043384-44048579 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44046925 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 117 (S117T)
Ref Sequence ENSEMBL: ENSMUSP00000110489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114840] [ENSMUST00000214627] [ENSMUST00000215156] [ENSMUST00000215809]
Predicted Effect possibly damaging
Transcript: ENSMUST00000114840
AA Change: S117T

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110489
Gene: ENSMUSG00000032011
AA Change: S117T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGv 33 107 2.13e-7 SMART
low complexity region 145 154 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000214627
Predicted Effect probably benign
Transcript: ENSMUST00000215156
Predicted Effect possibly damaging
Transcript: ENSMUST00000215809
AA Change: S117T

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: This gene encodes a glycoprotein that is anchored to the cell surface of thymocytes, neuronal and other cells through a glycosyl-phosphatidylinositol moiety. A soluble form of the encoded protein has also been detected in serum and cerebrospinal fluid. The encoded protein undergoes further processing to generate the mature protein which mediates cell-cell interactions to trigger downstream signaling pathways. [provided by RefSeq, Jul 2015]
PHENOTYPE: Homozygous null mice are viable, fertile, and display no abnormalities in the brain and spinal cord, have normal axonal development and regeneration and no behavioral abnormalities. Long term potentiation is inhibited in the dentate gyrus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add3 C T 19: 53,216,899 R27* probably null Het
Armc3 T A 2: 19,293,136 Y573N probably damaging Het
BC024978 G A 7: 27,201,123 A176T probably damaging Het
Bod1l A C 5: 41,819,938 N1344K probably benign Het
Camta1 T G 4: 151,148,523 N231T possibly damaging Het
Capza2 T A 6: 17,654,121 Y57* probably null Het
Ccdc186 T A 19: 56,792,000 I871F probably damaging Het
Cntnap5b A G 1: 100,431,849 probably null Het
Dnah2 G T 11: 69,549,097 probably null Het
Fhod3 T C 18: 25,090,755 F1053L probably damaging Het
Foxj1 A G 11: 116,332,375 Y201H possibly damaging Het
Gatad2b T A 3: 90,350,415 I210N probably benign Het
Gba T A 3: 89,204,362 I112N probably damaging Het
Gbp2 T C 3: 142,633,447 V420A probably benign Het
Gm3106 T G 5: 94,218,237 N71K probably benign Het
Gm8251 A C 1: 44,061,615 S108A probably benign Het
Golga3 T A 5: 110,209,855 H1072Q probably damaging Het
Gpr150 C T 13: 76,055,873 A318T probably benign Het
Gpr6 T C 10: 41,070,960 N209D probably damaging Het
Grin2b T C 6: 135,732,948 N1200S possibly damaging Het
Ifi207 G A 1: 173,730,252 H307Y unknown Het
Il20ra A T 10: 19,742,941 I46F probably damaging Het
Lvrn A G 18: 46,900,503 D927G probably benign Het
Nlrc4 G T 17: 74,445,203 D728E probably damaging Het
Nup107 T C 10: 117,762,135 D630G probably benign Het
Olfr378 A T 11: 73,425,164 I273N probably benign Het
Olfr787 T C 10: 129,462,757 I27T probably benign Het
Pclo C A 5: 14,679,729 A2867D unknown Het
Perm1 A G 4: 156,219,815 T754A possibly damaging Het
Plpbp G T 8: 27,051,297 V162L probably benign Het
Plscr4 A T 9: 92,488,641 E220D probably benign Het
Ppp2r3a A T 9: 101,212,527 M199K probably benign Het
Rassf6 T C 5: 90,606,807 E204G probably damaging Het
Reln A C 5: 22,047,947 D667E probably damaging Het
Rere A G 4: 150,610,953 I462V unknown Het
Rpain A G 11: 70,971,909 E76G possibly damaging Het
Strc T G 2: 121,369,026 I1311L probably benign Het
Svil A G 18: 5,092,937 M1385V probably benign Het
Syne2 T A 12: 76,066,587 D1083E probably benign Het
Szt2 T A 4: 118,389,006 H986L probably damaging Het
Tcl1b2 G T 12: 105,147,234 probably null Het
Tmem183a A T 1: 134,354,758 I203N probably damaging Het
Tmprss11g T C 5: 86,496,632 I118V probably benign Het
Tsen34 T C 7: 3,694,807 V69A possibly damaging Het
Ttn T C 2: 76,886,799 Q7506R unknown Het
Vmn1r184 T C 7: 26,267,680 S284P probably damaging Het
Wdr19 A G 5: 65,240,862 D810G probably benign Het
Zer1 T C 2: 30,103,432 D554G probably damaging Het
Zfp626 A T 7: 27,818,343 T250S probably benign Het
Other mutations in Thy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02832:Thy1 APN 9 44046814 missense probably benign 0.00
R0551:Thy1 UTSW 9 44047348 missense probably damaging 1.00
R0621:Thy1 UTSW 9 44046733 missense probably damaging 1.00
R1774:Thy1 UTSW 9 44047339 missense probably benign 0.07
R3625:Thy1 UTSW 9 44046731 missense probably damaging 1.00
R4724:Thy1 UTSW 9 44047348 missense probably damaging 1.00
R7667:Thy1 UTSW 9 44047435 missense probably damaging 1.00
R7684:Thy1 UTSW 9 44046558 missense unknown
Predicted Primers PCR Primer
(F):5'- TGCCGCCATGAGAATAACAC -3'
(R):5'- ATAGACAGCAGCAGTTTCCC -3'

Sequencing Primer
(F):5'- ATCCAGCATGAGTTCAGCCTG -3'
(R):5'- TTTCCCAGGAGACCAGCAGTTAG -3'
Posted On2019-06-26