Incidental Mutation 'R7190:Olfr378'
ID559559
Institutional Source Beutler Lab
Gene Symbol Olfr378
Ensembl Gene ENSMUSG00000055971
Gene Nameolfactory receptor 378
SynonymsMOR135-2, GA_x6K02T2P1NL-3586282-3585338
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R7190 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location73424609-73428477 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 73425164 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 273 (I273N)
Ref Sequence ENSEMBL: ENSMUSP00000066971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069790]
Predicted Effect probably benign
Transcript: ENSMUST00000069790
AA Change: I273N

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000066971
Gene: ENSMUSG00000055971
AA Change: I273N

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.3e-55 PFAM
Pfam:7TM_GPCR_Srsx 35 297 7.9e-6 PFAM
Pfam:7tm_1 41 290 3.8e-25 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add3 C T 19: 53,216,899 R27* probably null Het
Armc3 T A 2: 19,293,136 Y573N probably damaging Het
BC024978 G A 7: 27,201,123 A176T probably damaging Het
Bod1l A C 5: 41,819,938 N1344K probably benign Het
Camta1 T G 4: 151,148,523 N231T possibly damaging Het
Capza2 T A 6: 17,654,121 Y57* probably null Het
Ccdc186 T A 19: 56,792,000 I871F probably damaging Het
Cntnap5b A G 1: 100,431,849 probably null Het
Dnah2 G T 11: 69,549,097 probably null Het
Fhod3 T C 18: 25,090,755 F1053L probably damaging Het
Foxj1 A G 11: 116,332,375 Y201H possibly damaging Het
Gatad2b T A 3: 90,350,415 I210N probably benign Het
Gba T A 3: 89,204,362 I112N probably damaging Het
Gbp2 T C 3: 142,633,447 V420A probably benign Het
Gm3106 T G 5: 94,218,237 N71K probably benign Het
Gm8251 A C 1: 44,061,615 S108A probably benign Het
Golga3 T A 5: 110,209,855 H1072Q probably damaging Het
Gpr150 C T 13: 76,055,873 A318T probably benign Het
Gpr6 T C 10: 41,070,960 N209D probably damaging Het
Grin2b T C 6: 135,732,948 N1200S possibly damaging Het
Ifi207 G A 1: 173,730,252 H307Y unknown Het
Il20ra A T 10: 19,742,941 I46F probably damaging Het
Lvrn A G 18: 46,900,503 D927G probably benign Het
Nlrc4 G T 17: 74,445,203 D728E probably damaging Het
Nup107 T C 10: 117,762,135 D630G probably benign Het
Olfr787 T C 10: 129,462,757 I27T probably benign Het
Pclo C A 5: 14,679,729 A2867D unknown Het
Perm1 A G 4: 156,219,815 T754A possibly damaging Het
Plpbp G T 8: 27,051,297 V162L probably benign Het
Plscr4 A T 9: 92,488,641 E220D probably benign Het
Ppp2r3a A T 9: 101,212,527 M199K probably benign Het
Rassf6 T C 5: 90,606,807 E204G probably damaging Het
Reln A C 5: 22,047,947 D667E probably damaging Het
Rere A G 4: 150,610,953 I462V unknown Het
Rpain A G 11: 70,971,909 E76G possibly damaging Het
Strc T G 2: 121,369,026 I1311L probably benign Het
Svil A G 18: 5,092,937 M1385V probably benign Het
Syne2 T A 12: 76,066,587 D1083E probably benign Het
Szt2 T A 4: 118,389,006 H986L probably damaging Het
Tcl1b2 G T 12: 105,147,234 probably null Het
Thy1 T A 9: 44,046,925 S117T possibly damaging Het
Tmem183a A T 1: 134,354,758 I203N probably damaging Het
Tmprss11g T C 5: 86,496,632 I118V probably benign Het
Tsen34 T C 7: 3,694,807 V69A possibly damaging Het
Ttn T C 2: 76,886,799 Q7506R unknown Het
Vmn1r184 T C 7: 26,267,680 S284P probably damaging Het
Wdr19 A G 5: 65,240,862 D810G probably benign Het
Zer1 T C 2: 30,103,432 D554G probably damaging Het
Zfp626 A T 7: 27,818,343 T250S probably benign Het
Other mutations in Olfr378
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01996:Olfr378 APN 11 73425968 missense probably damaging 1.00
IGL02427:Olfr378 APN 11 73425661 missense probably damaging 1.00
IGL03089:Olfr378 APN 11 73425183 missense probably benign
R0443:Olfr378 UTSW 11 73425755 missense probably damaging 1.00
R1497:Olfr378 UTSW 11 73425827 missense possibly damaging 0.88
R2005:Olfr378 UTSW 11 73425239 missense probably damaging 1.00
R2029:Olfr378 UTSW 11 73425362 missense probably benign 0.00
R2140:Olfr378 UTSW 11 73425881 missense probably damaging 0.98
R3551:Olfr378 UTSW 11 73425852 missense probably benign 0.00
R3552:Olfr378 UTSW 11 73425852 missense probably benign 0.00
R4433:Olfr378 UTSW 11 73425711 missense possibly damaging 0.50
R4546:Olfr378 UTSW 11 73425186 missense probably benign 0.23
R4686:Olfr378 UTSW 11 73425438 missense probably benign 0.35
R5168:Olfr378 UTSW 11 73425843 missense probably benign 0.01
R5567:Olfr378 UTSW 11 73425446 missense probably damaging 1.00
R5755:Olfr378 UTSW 11 73425731 missense probably benign 0.22
R7287:Olfr378 UTSW 11 73425843 missense probably benign 0.01
R7404:Olfr378 UTSW 11 73425593 missense probably damaging 1.00
R7462:Olfr378 UTSW 11 73425470 missense probably benign 0.06
R7544:Olfr378 UTSW 11 73425770 missense probably damaging 1.00
R7702:Olfr378 UTSW 11 73433349 unclassified probably benign
X0010:Olfr378 UTSW 11 73425151 missense possibly damaging 0.59
Z1088:Olfr378 UTSW 11 73425105 unclassified probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTAAACAGAGGCATCCATGGTGAG -3'
(R):5'- GGGGTCCTATAGTTGTACTCCC -3'

Sequencing Primer
(F):5'- GCATCCATGGTGAGGAAAATTTTG -3'
(R):5'- GGGTCCTATAGTTGTACTCCCTTTCC -3'
Posted On2019-06-26