Incidental Mutation 'R7190:Foxj1'
ID559560
Institutional Source Beutler Lab
Gene Symbol Foxj1
Ensembl Gene ENSMUSG00000034227
Gene Nameforkhead box J1
SynonymsHfh4, HFH-4, FKHL-13
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7190 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location116330704-116335399 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116332375 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 201 (Y201H)
Ref Sequence ENSEMBL: ENSMUSP00000038351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036215] [ENSMUST00000100202] [ENSMUST00000106398]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036215
AA Change: Y201H

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000038351
Gene: ENSMUSG00000034227
AA Change: Y201H

DomainStartEndE-ValueType
low complexity region 10 26 N/A INTRINSIC
FH 119 209 3.8e-56 SMART
low complexity region 246 271 N/A INTRINSIC
low complexity region 291 303 N/A INTRINSIC
low complexity region 316 340 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100202
SMART Domains Protein: ENSMUSP00000097776
Gene: ENSMUSG00000052949

DomainStartEndE-ValueType
RING 277 315 5.64e-4 SMART
low complexity region 345 358 N/A INTRINSIC
low complexity region 427 444 N/A INTRINSIC
low complexity region 446 457 N/A INTRINSIC
low complexity region 552 562 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106398
SMART Domains Protein: ENSMUSP00000102006
Gene: ENSMUSG00000052949

DomainStartEndE-ValueType
RING 277 315 5.64e-4 SMART
low complexity region 345 358 N/A INTRINSIC
low complexity region 427 444 N/A INTRINSIC
low complexity region 446 457 N/A INTRINSIC
low complexity region 552 562 N/A INTRINSIC
low complexity region 563 574 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149147
SMART Domains Protein: ENSMUSP00000122483
Gene: ENSMUSG00000052949

DomainStartEndE-ValueType
RING 102 140 5.64e-4 SMART
low complexity region 170 183 N/A INTRINSIC
low complexity region 252 269 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 377 387 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the forkhead family of transcription factors. Similar genes in zebrafish and mouse have been shown to regulate the transcription of genes that control the production of motile cilia. The mouse ortholog also functions in the determination of left-right asymmetry. Polymorphisms in this gene are associated with systemic lupus erythematosus and allergic rhinitis.[provided by RefSeq, Sep 2009]
PHENOTYPE: Animals homozygous for targeted mutations in this gene exhibit random determination of left-right asymmetry and defective ciliogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add3 C T 19: 53,216,899 R27* probably null Het
Armc3 T A 2: 19,293,136 Y573N probably damaging Het
BC024978 G A 7: 27,201,123 A176T probably damaging Het
Bod1l A C 5: 41,819,938 N1344K probably benign Het
Camta1 T G 4: 151,148,523 N231T possibly damaging Het
Capza2 T A 6: 17,654,121 Y57* probably null Het
Ccdc186 T A 19: 56,792,000 I871F probably damaging Het
Cntnap5b A G 1: 100,431,849 probably null Het
Dnah2 G T 11: 69,549,097 probably null Het
Fhod3 T C 18: 25,090,755 F1053L probably damaging Het
Gatad2b T A 3: 90,350,415 I210N probably benign Het
Gba T A 3: 89,204,362 I112N probably damaging Het
Gbp2 T C 3: 142,633,447 V420A probably benign Het
Gm3106 T G 5: 94,218,237 N71K probably benign Het
Gm8251 A C 1: 44,061,615 S108A probably benign Het
Golga3 T A 5: 110,209,855 H1072Q probably damaging Het
Gpr150 C T 13: 76,055,873 A318T probably benign Het
Gpr6 T C 10: 41,070,960 N209D probably damaging Het
Grin2b T C 6: 135,732,948 N1200S possibly damaging Het
Ifi207 G A 1: 173,730,252 H307Y unknown Het
Il20ra A T 10: 19,742,941 I46F probably damaging Het
Lvrn A G 18: 46,900,503 D927G probably benign Het
Nlrc4 G T 17: 74,445,203 D728E probably damaging Het
Nup107 T C 10: 117,762,135 D630G probably benign Het
Olfr378 A T 11: 73,425,164 I273N probably benign Het
Olfr787 T C 10: 129,462,757 I27T probably benign Het
Pclo C A 5: 14,679,729 A2867D unknown Het
Perm1 A G 4: 156,219,815 T754A possibly damaging Het
Plpbp G T 8: 27,051,297 V162L probably benign Het
Plscr4 A T 9: 92,488,641 E220D probably benign Het
Ppp2r3a A T 9: 101,212,527 M199K probably benign Het
Rassf6 T C 5: 90,606,807 E204G probably damaging Het
Reln A C 5: 22,047,947 D667E probably damaging Het
Rere A G 4: 150,610,953 I462V unknown Het
Rpain A G 11: 70,971,909 E76G possibly damaging Het
Strc T G 2: 121,369,026 I1311L probably benign Het
Svil A G 18: 5,092,937 M1385V probably benign Het
Syne2 T A 12: 76,066,587 D1083E probably benign Het
Szt2 T A 4: 118,389,006 H986L probably damaging Het
Tcl1b2 G T 12: 105,147,234 probably null Het
Thy1 T A 9: 44,046,925 S117T possibly damaging Het
Tmem183a A T 1: 134,354,758 I203N probably damaging Het
Tmprss11g T C 5: 86,496,632 I118V probably benign Het
Tsen34 T C 7: 3,694,807 V69A possibly damaging Het
Ttn T C 2: 76,886,799 Q7506R unknown Het
Vmn1r184 T C 7: 26,267,680 S284P probably damaging Het
Wdr19 A G 5: 65,240,862 D810G probably benign Het
Zer1 T C 2: 30,103,432 D554G probably damaging Het
Zfp626 A T 7: 27,818,343 T250S probably benign Het
Other mutations in Foxj1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01920:Foxj1 APN 11 116331920 missense possibly damaging 0.68
IGL02416:Foxj1 APN 11 116332003 missense probably benign
R0386:Foxj1 UTSW 11 116331803 missense possibly damaging 0.95
R0615:Foxj1 UTSW 11 116334082 missense possibly damaging 0.56
R5352:Foxj1 UTSW 11 116334079 missense possibly damaging 0.85
R7062:Foxj1 UTSW 11 116331993 missense probably benign
R7161:Foxj1 UTSW 11 116332408 missense probably damaging 1.00
R7399:Foxj1 UTSW 11 116332254 missense possibly damaging 0.94
R8016:Foxj1 UTSW 11 116331849 missense probably damaging 1.00
Z1177:Foxj1 UTSW 11 116332267 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCTCCTCAAACTCCTGAAG -3'
(R):5'- TGAGCAGGCAGATATCCCAG -3'

Sequencing Primer
(F):5'- TCAAACTCCTGAAGCAGCTG -3'
(R):5'- CTCATACCCTGTGGCTGGTG -3'
Posted On2019-06-26