Incidental Mutation 'R7190:Ccdc186'
ID559569
Institutional Source Beutler Lab
Gene Symbol Ccdc186
Ensembl Gene ENSMUSG00000035173
Gene Namecoiled-coil domain containing 186
SynonymsOtg1, A630007B06Rik, 1810028B20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7190 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location56787481-56822190 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 56792000 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 871 (I871F)
Ref Sequence ENSEMBL: ENSMUSP00000075454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076085] [ENSMUST00000118592]
Predicted Effect probably damaging
Transcript: ENSMUST00000076085
AA Change: I871F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075454
Gene: ENSMUSG00000035173
AA Change: I871F

DomainStartEndE-ValueType
internal_repeat_1 7 104 8.63e-6 PROSPERO
internal_repeat_1 119 216 8.63e-6 PROSPERO
low complexity region 252 264 N/A INTRINSIC
low complexity region 426 447 N/A INTRINSIC
low complexity region 527 538 N/A INTRINSIC
low complexity region 619 631 N/A INTRINSIC
low complexity region 641 651 N/A INTRINSIC
low complexity region 656 670 N/A INTRINSIC
Blast:SPEC 671 799 1e-37 BLAST
coiled coil region 874 913 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118592
AA Change: I871F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113457
Gene: ENSMUSG00000035173
AA Change: I871F

DomainStartEndE-ValueType
internal_repeat_1 7 104 8.63e-6 PROSPERO
internal_repeat_1 119 216 8.63e-6 PROSPERO
low complexity region 252 264 N/A INTRINSIC
low complexity region 426 447 N/A INTRINSIC
low complexity region 527 538 N/A INTRINSIC
low complexity region 619 631 N/A INTRINSIC
low complexity region 641 651 N/A INTRINSIC
low complexity region 656 670 N/A INTRINSIC
Blast:SPEC 671 799 1e-37 BLAST
coiled coil region 874 913 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000122539
Gene: ENSMUSG00000035173
AA Change: I146F

DomainStartEndE-ValueType
Blast:SPEC 2 75 2e-15 BLAST
coiled coil region 149 188 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add3 C T 19: 53,216,899 R27* probably null Het
Armc3 T A 2: 19,293,136 Y573N probably damaging Het
BC024978 G A 7: 27,201,123 A176T probably damaging Het
Bod1l A C 5: 41,819,938 N1344K probably benign Het
Camta1 T G 4: 151,148,523 N231T possibly damaging Het
Capza2 T A 6: 17,654,121 Y57* probably null Het
Cntnap5b A G 1: 100,431,849 probably null Het
Dnah2 G T 11: 69,549,097 probably null Het
Fhod3 T C 18: 25,090,755 F1053L probably damaging Het
Foxj1 A G 11: 116,332,375 Y201H possibly damaging Het
Gatad2b T A 3: 90,350,415 I210N probably benign Het
Gba T A 3: 89,204,362 I112N probably damaging Het
Gbp2 T C 3: 142,633,447 V420A probably benign Het
Gm3106 T G 5: 94,218,237 N71K probably benign Het
Gm8251 A C 1: 44,061,615 S108A probably benign Het
Golga3 T A 5: 110,209,855 H1072Q probably damaging Het
Gpr150 C T 13: 76,055,873 A318T probably benign Het
Gpr6 T C 10: 41,070,960 N209D probably damaging Het
Grin2b T C 6: 135,732,948 N1200S possibly damaging Het
Ifi207 G A 1: 173,730,252 H307Y unknown Het
Il20ra A T 10: 19,742,941 I46F probably damaging Het
Lvrn A G 18: 46,900,503 D927G probably benign Het
Nlrc4 G T 17: 74,445,203 D728E probably damaging Het
Nup107 T C 10: 117,762,135 D630G probably benign Het
Olfr378 A T 11: 73,425,164 I273N probably benign Het
Olfr787 T C 10: 129,462,757 I27T probably benign Het
Pclo C A 5: 14,679,729 A2867D unknown Het
Perm1 A G 4: 156,219,815 T754A possibly damaging Het
Plpbp G T 8: 27,051,297 V162L probably benign Het
Plscr4 A T 9: 92,488,641 E220D probably benign Het
Ppp2r3a A T 9: 101,212,527 M199K probably benign Het
Rassf6 T C 5: 90,606,807 E204G probably damaging Het
Reln A C 5: 22,047,947 D667E probably damaging Het
Rere A G 4: 150,610,953 I462V unknown Het
Rpain A G 11: 70,971,909 E76G possibly damaging Het
Strc T G 2: 121,369,026 I1311L probably benign Het
Svil A G 18: 5,092,937 M1385V probably benign Het
Syne2 T A 12: 76,066,587 D1083E probably benign Het
Szt2 T A 4: 118,389,006 H986L probably damaging Het
Tcl1b2 G T 12: 105,147,234 probably null Het
Thy1 T A 9: 44,046,925 S117T possibly damaging Het
Tmem183a A T 1: 134,354,758 I203N probably damaging Het
Tmprss11g T C 5: 86,496,632 I118V probably benign Het
Tsen34 T C 7: 3,694,807 V69A possibly damaging Het
Ttn T C 2: 76,886,799 Q7506R unknown Het
Vmn1r184 T C 7: 26,267,680 S284P probably damaging Het
Wdr19 A G 5: 65,240,862 D810G probably benign Het
Zer1 T C 2: 30,103,432 D554G probably damaging Het
Zfp626 A T 7: 27,818,343 T250S probably benign Het
Other mutations in Ccdc186
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Ccdc186 APN 19 56813447 missense probably benign 0.18
IGL00976:Ccdc186 APN 19 56797500 missense probably damaging 1.00
IGL01146:Ccdc186 APN 19 56809317 missense probably damaging 1.00
IGL01316:Ccdc186 APN 19 56813413 missense probably benign 0.01
IGL01627:Ccdc186 APN 19 56792020 missense probably damaging 1.00
IGL02325:Ccdc186 APN 19 56813356 missense probably benign 0.03
IGL02755:Ccdc186 APN 19 56813396 missense probably benign 0.06
IGL02899:Ccdc186 APN 19 56793488 missense probably benign 0.00
IGL03408:Ccdc186 APN 19 56798731 missense probably benign 0.00
receding UTSW 19 56800129 missense probably damaging 1.00
R1256:Ccdc186 UTSW 19 56797621 missense probably benign 0.20
R1728:Ccdc186 UTSW 19 56809220 missense probably benign 0.04
R1729:Ccdc186 UTSW 19 56809220 missense probably benign 0.04
R1784:Ccdc186 UTSW 19 56809220 missense probably benign 0.04
R1813:Ccdc186 UTSW 19 56800169 missense probably benign 0.03
R1909:Ccdc186 UTSW 19 56793361 missense probably damaging 1.00
R2110:Ccdc186 UTSW 19 56800142 missense possibly damaging 0.80
R2319:Ccdc186 UTSW 19 56797567 missense possibly damaging 0.50
R2351:Ccdc186 UTSW 19 56798697 missense possibly damaging 0.89
R2970:Ccdc186 UTSW 19 56806998 missense probably damaging 1.00
R4159:Ccdc186 UTSW 19 56793492 nonsense probably null
R4898:Ccdc186 UTSW 19 56802000 splice site probably null
R4910:Ccdc186 UTSW 19 56798691 missense probably damaging 0.98
R5325:Ccdc186 UTSW 19 56813181 missense probably damaging 0.99
R5338:Ccdc186 UTSW 19 56813257 missense possibly damaging 0.87
R5662:Ccdc186 UTSW 19 56793488 missense probably benign
R5773:Ccdc186 UTSW 19 56813487 missense probably benign 0.06
R6621:Ccdc186 UTSW 19 56813487 missense probably benign 0.06
R6806:Ccdc186 UTSW 19 56800129 missense probably damaging 1.00
R6908:Ccdc186 UTSW 19 56791939 critical splice donor site probably null
R6977:Ccdc186 UTSW 19 56798787 missense probably benign 0.05
R7108:Ccdc186 UTSW 19 56798760 missense probably damaging 1.00
R7407:Ccdc186 UTSW 19 56813385 missense probably benign 0.00
R7408:Ccdc186 UTSW 19 56808178 missense probably damaging 1.00
R7437:Ccdc186 UTSW 19 56806997 missense probably damaging 1.00
RF014:Ccdc186 UTSW 19 56813472 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGTACCAAGACACCCTGTACTAG -3'
(R):5'- TTCTGCAAGCACCCAGAGTATC -3'

Sequencing Primer
(F):5'- GGTTAAGAGAACTGACTGCTCTTCC -3'
(R):5'- CTGCAAGCACCCAGAGTATCATTTTG -3'
Posted On2019-06-26