Incidental Mutation 'R7191:Kin'
ID559574
Institutional Source Beutler Lab
Gene Symbol Kin
Ensembl Gene ENSMUSG00000037262
Gene NameKin17 DNA and RNA binding protein
SynonymsKin17
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R7191 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location10080593-10092806 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 10091793 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 151 (R151Q)
Ref Sequence ENSEMBL: ENSMUSP00000043614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042290] [ENSMUST00000042512]
Predicted Effect probably benign
Transcript: ENSMUST00000042290
SMART Domains Protein: ENSMUSP00000046530
Gene: ENSMUSG00000037254

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VIT 60 189 4.35e-77 SMART
VWA 312 498 6.6e-32 SMART
Pfam:ITI_HC_C 740 925 1.7e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000042512
AA Change: R151Q

PolyPhen 2 Score 0.318 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000043614
Gene: ENSMUSG00000037262
AA Change: R151Q

DomainStartEndE-ValueType
ZnF_C2H2 26 50 2.35e1 SMART
Kin17_mid 52 178 5.41e-89 SMART
low complexity region 209 224 N/A INTRINSIC
low complexity region 242 258 N/A INTRINSIC
low complexity region 290 300 N/A INTRINSIC
KOW 334 361 1.97e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear protein that forms intranuclear foci during proliferation and is redistributed in the nucleoplasm during the cell cycle. Short-wave ultraviolet light provokes the relocalization of the protein, suggesting its participation in the cellular response to DNA damage. Originally selected based on protein-binding with RecA antibodies, the mouse protein presents a limited similarity with a functional domain of the bacterial RecA protein, a characteristic shared by this human ortholog. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2012]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik T A 16: 21,653,564 I129F probably benign Het
Ank2 T A 3: 126,946,392 T1948S unknown Het
Arap1 T C 7: 101,384,992 C214R probably benign Het
BC024978 G A 7: 27,201,123 A176T probably damaging Het
Ccdc82 C T 9: 13,252,472 Q130* probably null Het
Cfh A C 1: 140,112,567 V597G probably benign Het
Clp1 A T 2: 84,724,146 C226* probably null Het
Cyp39a1 G A 17: 43,731,019 W372* probably null Het
Dchs1 G A 7: 105,765,439 P799S possibly damaging Het
Dmbt1 A T 7: 131,044,520 N167I unknown Het
Dock10 A G 1: 80,540,331 S1310P possibly damaging Het
Fam83h C T 15: 76,003,037 G817D probably damaging Het
Fras1 A G 5: 96,614,912 T758A probably benign Het
Fryl T C 5: 73,072,912 H1634R probably damaging Het
Gcg C G 2: 62,476,839 G126A probably damaging Het
Gm4763 C T 7: 24,723,334 V105I possibly damaging Het
Gm4951 A T 18: 60,246,257 D288V probably benign Het
Gne T C 4: 44,040,266 K633E probably benign Het
Gpr4 T C 7: 19,223,230 V359A probably benign Het
Gprc5c C T 11: 114,868,617 T422M possibly damaging Het
Gria2 C A 3: 80,732,085 V207L probably benign Het
Hid1 T C 11: 115,348,469 *789W probably null Het
Jakmip3 G A 7: 138,989,528 probably null Het
Krt16 T C 11: 100,246,658 E407G probably damaging Het
Krt81 T C 15: 101,460,229 D381G probably damaging Het
Lrrc34 C T 3: 30,624,878 G357S possibly damaging Het
Mipol1 A G 12: 57,457,066 Q340R probably benign Het
Mpzl3 T G 9: 45,055,244 M1R probably null Het
Nrcam A G 12: 44,572,244 N852S probably benign Het
Nudcd2 C T 11: 40,736,603 Q117* probably null Het
Nup35 A T 2: 80,658,379 E320V probably damaging Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr477 G A 7: 107,990,646 V94M possibly damaging Het
Pkhd1 T C 1: 20,558,719 H668R probably benign Het
Ptprc T A 1: 138,101,044 D333V probably benign Het
Rdh16 A G 10: 127,813,418 K248E probably benign Het
Samd4b C A 7: 28,414,261 G93V probably benign Het
Scgn A G 13: 23,981,493 I78T probably benign Het
Slfn14 T C 11: 83,276,749 I647V probably benign Het
Smyd5 T C 6: 85,440,111 V157A probably benign Het
Syde2 T C 3: 146,002,358 M951T probably benign Het
Tas2r105 T C 6: 131,686,982 N161S probably damaging Het
Tbck T C 3: 132,737,555 F581L probably damaging Het
Traip A G 9: 107,970,017 N352D probably benign Het
Trim29 A G 9: 43,311,609 Y245C probably damaging Het
Trpv4 T C 5: 114,633,140 I443V probably benign Het
Usp36 C T 11: 118,268,834 E595K probably benign Het
Vmn2r51 T A 7: 10,100,553 Y186F probably null Het
Vmn2r97 A G 17: 18,930,286 Y465C probably damaging Het
Wrb A G 16: 96,151,945 I79V possibly damaging Het
Zfp277 A T 12: 40,329,562 H324Q probably damaging Het
Zfp987 A G 4: 146,121,903 D17G probably damaging Het
Other mutations in Kin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Kin APN 2 10080704 missense probably damaging 1.00
IGL00898:Kin APN 2 10080706 missense probably damaging 1.00
IGL00907:Kin APN 2 10080704 missense probably damaging 1.00
IGL00907:Kin APN 2 10080706 missense probably damaging 1.00
IGL00941:Kin APN 2 10080704 missense probably damaging 1.00
IGL00941:Kin APN 2 10080706 missense probably damaging 1.00
IGL00971:Kin APN 2 10090348 missense possibly damaging 0.88
IGL01570:Kin APN 2 10091952 missense probably benign 0.05
R0090:Kin UTSW 2 10085773 missense possibly damaging 0.53
R0656:Kin UTSW 2 10085720 splice site probably benign
R0827:Kin UTSW 2 10090376 splice site probably benign
R1530:Kin UTSW 2 10092339 missense probably damaging 1.00
R4879:Kin UTSW 2 10080644 missense probably benign 0.01
R6728:Kin UTSW 2 10090148 missense possibly damaging 0.95
R7209:Kin UTSW 2 10091753 missense possibly damaging 0.46
R7242:Kin UTSW 2 10091793 missense probably benign 0.32
R7650:Kin UTSW 2 10092168 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GTCACTGCATGCATAGTGTG -3'
(R):5'- TTGGTCCCAAAGAGCTTGAC -3'

Sequencing Primer
(F):5'- GCAGAGCTGGAATGCTTCG -3'
(R):5'- TCCCAAAGAGCTTGACTTGGATG -3'
Posted On2019-06-26