Incidental Mutation 'R7191:Clp1'
ID559577
Institutional Source Beutler Lab
Gene Symbol Clp1
Ensembl Gene ENSMUSG00000027079
Gene NameCLP1, cleavage and polyadenylation factor I subunit
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_133840; MGI: 2138968

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7191 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location84722104-84727350 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 84724146 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 226 (C226*)
Ref Sequence ENSEMBL: ENSMUSP00000028475 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028475] [ENSMUST00000165219]
Predicted Effect probably null
Transcript: ENSMUST00000028475
AA Change: C226*
SMART Domains Protein: ENSMUSP00000028475
Gene: ENSMUSG00000027079
AA Change: C226*

DomainStartEndE-ValueType
Pfam:CLP1_N 15 107 1.7e-36 PFAM
Pfam:CLP1_P 121 307 2e-79 PFAM
Pfam:Clp1 312 423 1.3e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000165219
AA Change: C226*
SMART Domains Protein: ENSMUSP00000129300
Gene: ENSMUSG00000027079
AA Change: C226*

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
Pfam:MobB 115 230 5.7e-24 PFAM
Pfam:Clp1 232 424 3e-62 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Clp1 family. The encoded protein is a multifunctional kinase which is a component of the tRNA splicing endonuclease complex and a component of the pre-mRNA cleavage complex II. This protein is implicated in tRNA, mRNA, and siRNA maturation. Mutations in this gene are associated with pontocerebellar hypoplasia type 10 (PCH10). Alternatively splice transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a kinase dead allele exhibit background sensitive lethality, motor neuron degeneration, defects in diaphragm innervation, progressive muscle weakness and impaired pre-tRNA processing. Mice homozygous for a globally targeted allele exhibit complete embryonic lethality. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Gene trapped(6)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik T A 16: 21,653,564 I129F probably benign Het
Ank2 T A 3: 126,946,392 T1948S unknown Het
Arap1 T C 7: 101,384,992 C214R probably benign Het
BC024978 G A 7: 27,201,123 A176T probably damaging Het
Ccdc82 C T 9: 13,252,472 Q130* probably null Het
Cfh A C 1: 140,112,567 V597G probably benign Het
Cyp39a1 G A 17: 43,731,019 W372* probably null Het
Dchs1 G A 7: 105,765,439 P799S possibly damaging Het
Dmbt1 A T 7: 131,044,520 N167I unknown Het
Dock10 A G 1: 80,540,331 S1310P possibly damaging Het
Fam83h C T 15: 76,003,037 G817D probably damaging Het
Fras1 A G 5: 96,614,912 T758A probably benign Het
Fryl T C 5: 73,072,912 H1634R probably damaging Het
Gcg C G 2: 62,476,839 G126A probably damaging Het
Gm4763 C T 7: 24,723,334 V105I possibly damaging Het
Gm4951 A T 18: 60,246,257 D288V probably benign Het
Gne T C 4: 44,040,266 K633E probably benign Het
Gpr4 T C 7: 19,223,230 V359A probably benign Het
Gprc5c C T 11: 114,868,617 T422M possibly damaging Het
Gria2 C A 3: 80,732,085 V207L probably benign Het
Hid1 T C 11: 115,348,469 *789W probably null Het
Jakmip3 G A 7: 138,989,528 probably null Het
Kin G A 2: 10,091,793 R151Q probably benign Het
Krt16 T C 11: 100,246,658 E407G probably damaging Het
Krt81 T C 15: 101,460,229 D381G probably damaging Het
Lrrc34 C T 3: 30,624,878 G357S possibly damaging Het
Mipol1 A G 12: 57,457,066 Q340R probably benign Het
Mpzl3 T G 9: 45,055,244 M1R probably null Het
Nrcam A G 12: 44,572,244 N852S probably benign Het
Nudcd2 C T 11: 40,736,603 Q117* probably null Het
Nup35 A T 2: 80,658,379 E320V probably damaging Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr477 G A 7: 107,990,646 V94M possibly damaging Het
Pkhd1 T C 1: 20,558,719 H668R probably benign Het
Ptprc T A 1: 138,101,044 D333V probably benign Het
Rdh16 A G 10: 127,813,418 K248E probably benign Het
Samd4b C A 7: 28,414,261 G93V probably benign Het
Scgn A G 13: 23,981,493 I78T probably benign Het
Slfn14 T C 11: 83,276,749 I647V probably benign Het
Smyd5 T C 6: 85,440,111 V157A probably benign Het
Syde2 T C 3: 146,002,358 M951T probably benign Het
Tas2r105 T C 6: 131,686,982 N161S probably damaging Het
Tbck T C 3: 132,737,555 F581L probably damaging Het
Traip A G 9: 107,970,017 N352D probably benign Het
Trim29 A G 9: 43,311,609 Y245C probably damaging Het
Trpv4 T C 5: 114,633,140 I443V probably benign Het
Usp36 C T 11: 118,268,834 E595K probably benign Het
Vmn2r51 T A 7: 10,100,553 Y186F probably null Het
Vmn2r97 A G 17: 18,930,286 Y465C probably damaging Het
Wrb A G 16: 96,151,945 I79V possibly damaging Het
Zfp277 A T 12: 40,329,562 H324Q probably damaging Het
Zfp987 A G 4: 146,121,903 D17G probably damaging Het
Other mutations in Clp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02725:Clp1 APN 2 84723864 missense probably benign 0.36
D4186:Clp1 UTSW 2 84725635 missense probably benign 0.00
R0540:Clp1 UTSW 2 84725591 missense possibly damaging 0.69
R0607:Clp1 UTSW 2 84725591 missense possibly damaging 0.69
R1954:Clp1 UTSW 2 84724051 missense probably damaging 1.00
R2908:Clp1 UTSW 2 84724144 missense possibly damaging 0.89
R4769:Clp1 UTSW 2 84725875 missense possibly damaging 0.53
R4949:Clp1 UTSW 2 84723742 missense possibly damaging 0.58
R5568:Clp1 UTSW 2 84725978 nonsense probably null
Z1177:Clp1 UTSW 2 84725963 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCCTGATTTTGGAAGCAACACAG -3'
(R):5'- TCCAGCCTGTAAAGCTTTTGG -3'

Sequencing Primer
(F):5'- TTTGGAAGCAACACAGTTCGAAC -3'
(R):5'- TGTAACTCAAGCTCCAGGGGTATC -3'
Posted On2019-06-26