Incidental Mutation 'R0591:B230118H07Rik'
ID55958
Institutional Source Beutler Lab
Gene Symbol B230118H07Rik
Ensembl Gene ENSMUSG00000027165
Gene NameRIKEN cDNA B230118H07 gene
SynonymsNWC
MMRRC Submission 038781-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R0591 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location101560781-101649532 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 101576117 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 155 (D155E)
Ref Sequence ENSEMBL: ENSMUSP00000097274 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000090513
AA Change: D155E

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000099682
AA Change: D155E

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000111231
AA Change: D155E

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000128898
AA Change: D155E

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000136601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138903
Predicted Effect probably benign
Transcript: ENSMUST00000160037
AA Change: D155E

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000160722
AA Change: D155E

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000177152
AA Change: D3E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0649 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.2%
  • 10x: 97.7%
  • 20x: 95.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that was identified as a cellular interacting partner of non-structural protein 10 of the severe acute respiratory syndrome coronavirus (SARS-CoV). The encoded protein may function as a negative regulator of transcription. There is a pseudogene for this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygous deletion of one of two alternative first exons and its promoter has no obvious phenotypic effect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G T 3: 138,068,943 E1298* probably null Het
Adam19 T C 11: 46,121,411 probably benign Het
Agt A T 8: 124,556,939 S480R possibly damaging Het
Anapc1 G T 2: 128,619,332 D1769E probably benign Het
Aox4 T C 1: 58,239,102 probably benign Het
Apol9b G A 15: 77,735,630 V209I possibly damaging Het
Appl2 A T 10: 83,624,645 I116K possibly damaging Het
BC051665 A G 13: 60,784,608 probably benign Het
Cactin G T 10: 81,324,003 E89* probably null Het
Carf G T 1: 60,125,914 probably benign Het
Ccdc167 A G 17: 29,705,261 probably benign Het
Ceacam3 G A 7: 17,151,883 probably null Het
Clca4b T A 3: 144,915,592 K574* probably null Het
Crabp1 T A 9: 54,765,603 I64N probably damaging Het
Dgkd T A 1: 87,915,104 I118N probably damaging Het
Dglucy T C 12: 100,859,518 probably benign Het
Dock10 C T 1: 80,541,219 probably benign Het
Ednrb A T 14: 103,823,274 probably null Het
Ercc6 T C 14: 32,558,016 probably benign Het
Gm5538 C A 3: 59,752,129 Y334* probably null Het
Golga3 A C 5: 110,188,743 Q416P probably damaging Het
Gpr12 A G 5: 146,583,635 V159A probably benign Het
Heatr5a A T 12: 51,910,101 probably benign Het
Helz2 A G 2: 181,232,116 I2195T probably damaging Het
Hikeshi A T 7: 89,920,087 N76K possibly damaging Het
Hsd11b1 T C 1: 193,229,676 probably benign Het
Inhba A T 13: 16,026,820 K322N probably damaging Het
Katnal1 A T 5: 148,892,516 F291L probably damaging Het
Kcnj9 T C 1: 172,323,098 E316G probably damaging Het
Lrsam1 A G 2: 32,933,923 probably benign Het
Mcf2l T G 8: 13,018,751 S1075A probably benign Het
Mios T C 6: 8,215,470 V222A possibly damaging Het
Mycbp2 A T 14: 103,196,391 probably benign Het
Nars A T 18: 64,500,567 I544N probably damaging Het
Olfr993 A G 2: 85,414,690 L63P possibly damaging Het
Pbrm1 A G 14: 31,046,430 probably benign Het
Plcb4 A G 2: 135,955,012 probably benign Het
Pnliprp1 A G 19: 58,734,706 D213G probably damaging Het
Psap A G 10: 60,300,855 N538D possibly damaging Het
Ptdss1 A G 13: 66,972,650 probably benign Het
Rap1b G A 10: 117,818,617 probably benign Het
Rhcg T A 7: 79,594,772 probably benign Het
Ryr1 G A 7: 29,104,795 T550I possibly damaging Het
Samm50 G A 15: 84,211,168 G452R probably benign Het
Scin A G 12: 40,080,930 probably null Het
Sesn3 T C 9: 14,308,558 L81S probably damaging Het
Skint6 A C 4: 112,858,169 probably benign Het
Slc30a4 A T 2: 122,685,240 L411H probably damaging Het
Slc44a5 C T 3: 154,234,145 probably benign Het
Slc4a3 C T 1: 75,549,021 A255V probably damaging Het
Slc9b1 A G 3: 135,382,832 N318S possibly damaging Het
Tcp11l2 A T 10: 84,604,594 H287L probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tnks2 T A 19: 36,872,562 Y605N probably damaging Het
Topbp1 T A 9: 103,349,838 N1490K probably benign Het
Ube4b T G 4: 149,357,577 probably benign Het
Usp4 G A 9: 108,348,029 probably benign Het
Vezf1 A T 11: 88,068,435 probably benign Het
Vmn1r184 A T 7: 26,267,075 D82V probably damaging Het
Other mutations in B230118H07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03347:B230118H07Rik APN 2 101583519 critical splice donor site probably null
IGL03384:B230118H07Rik APN 2 101585263 missense probably benign 0.00
R0190:B230118H07Rik UTSW 2 101586430 missense probably benign 0.16
R0436:B230118H07Rik UTSW 2 101610519 splice site probably benign
R0880:B230118H07Rik UTSW 2 101576110 missense probably benign 0.32
R1608:B230118H07Rik UTSW 2 101610571 missense probably damaging 1.00
R6008:B230118H07Rik UTSW 2 101583553 missense possibly damaging 0.52
R6060:B230118H07Rik UTSW 2 101610605 missense probably benign 0.06
R6155:B230118H07Rik UTSW 2 101576010 critical splice donor site probably null
R6805:B230118H07Rik UTSW 2 101566459 missense probably benign 0.29
R7209:B230118H07Rik UTSW 2 101566382 makesense probably null
R7258:B230118H07Rik UTSW 2 101610592 missense probably null 0.96
R7680:B230118H07Rik UTSW 2 101610556 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCTTCTACAGCCAAACACCATTG -3'
(R):5'- AGTCAGGTTCACAGACGAAGACCC -3'

Sequencing Primer
(F):5'- GACTCTAAATTATCCCAAACCAAGG -3'
(R):5'- TACTTGGGGGAGATGACGAA -3'
Posted On2013-07-11