Incidental Mutation 'R7191:Olfml3'
ID559580
Institutional Source Beutler Lab
Gene Symbol Olfml3
Ensembl Gene ENSMUSG00000027848
Gene Nameolfactomedin-like 3
Synonyms2810002E22Rik, HNOEL-iso, mONT3, ONT3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7191 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location103722222-103738001 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103735860 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 402 (K402E)
Ref Sequence ENSEMBL: ENSMUSP00000029440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029440] [ENSMUST00000106852] [ENSMUST00000118317] [ENSMUST00000169286]
Predicted Effect probably damaging
Transcript: ENSMUST00000029440
AA Change: K402E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029440
Gene: ENSMUSG00000027848
AA Change: K402E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
Blast:OLF 65 133 8e-34 BLAST
OLF 137 401 9.22e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106852
Predicted Effect probably benign
Transcript: ENSMUST00000118317
SMART Domains Protein: ENSMUSP00000113998
Gene: ENSMUSG00000008730

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
low complexity region 87 99 N/A INTRINSIC
low complexity region 151 170 N/A INTRINSIC
S_TKc 190 518 3.39e-76 SMART
low complexity region 586 603 N/A INTRINSIC
low complexity region 679 695 N/A INTRINSIC
low complexity region 941 959 N/A INTRINSIC
low complexity region 1047 1063 N/A INTRINSIC
low complexity region 1095 1111 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169286
Meta Mutation Damage Score 0.1856 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the olfactomedin-like gene family which also includes genes encoding noelin, tiarin, myocilin, amassin, optimedin, photomedin, and latrophilin. The encoded protein is a secreted extracellular matrix glycoprotein with a C-terminal olfactomedin domain that facilitates protein-protein interactions, cell adhesion, and intercellular interactions. It serves as both a scaffold protein that recruits bone morphogenetic protein 1 to its substrate chordin, and as a vascular tissue remodeler with pro-angiogenic properties. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a disruption in this gene appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik T A 16: 21,653,564 I129F probably benign Het
Ank2 T A 3: 126,946,392 T1948S unknown Het
Arap1 T C 7: 101,384,992 C214R probably benign Het
BC024978 G A 7: 27,201,123 A176T probably damaging Het
Ccdc82 C T 9: 13,252,472 Q130* probably null Het
Cfh A C 1: 140,112,567 V597G probably benign Het
Clp1 A T 2: 84,724,146 C226* probably null Het
Cyp39a1 G A 17: 43,731,019 W372* probably null Het
Dchs1 G A 7: 105,765,439 P799S possibly damaging Het
Dmbt1 A T 7: 131,044,520 N167I unknown Het
Dock10 A G 1: 80,540,331 S1310P possibly damaging Het
Fam83h C T 15: 76,003,037 G817D probably damaging Het
Fras1 A G 5: 96,614,912 T758A probably benign Het
Fryl T C 5: 73,072,912 H1634R probably damaging Het
Gcg C G 2: 62,476,839 G126A probably damaging Het
Gm4763 C T 7: 24,723,334 V105I possibly damaging Het
Gm4951 A T 18: 60,246,257 D288V probably benign Het
Gne T C 4: 44,040,266 K633E probably benign Het
Gpr4 T C 7: 19,223,230 V359A probably benign Het
Gprc5c C T 11: 114,868,617 T422M possibly damaging Het
Gria2 C A 3: 80,732,085 V207L probably benign Het
Hid1 T C 11: 115,348,469 *789W probably null Het
Jakmip3 G A 7: 138,989,528 probably null Het
Kin G A 2: 10,091,793 R151Q probably benign Het
Krt16 T C 11: 100,246,658 E407G probably damaging Het
Krt81 T C 15: 101,460,229 D381G probably damaging Het
Lrrc34 C T 3: 30,624,878 G357S possibly damaging Het
Mipol1 A G 12: 57,457,066 Q340R probably benign Het
Mpzl3 T G 9: 45,055,244 M1R probably null Het
Nrcam A G 12: 44,572,244 N852S probably benign Het
Nudcd2 C T 11: 40,736,603 Q117* probably null Het
Nup35 A T 2: 80,658,379 E320V probably damaging Het
Olfr477 G A 7: 107,990,646 V94M possibly damaging Het
Pkhd1 T C 1: 20,558,719 H668R probably benign Het
Ptprc T A 1: 138,101,044 D333V probably benign Het
Rdh16 A G 10: 127,813,418 K248E probably benign Het
Samd4b C A 7: 28,414,261 G93V probably benign Het
Scgn A G 13: 23,981,493 I78T probably benign Het
Slfn14 T C 11: 83,276,749 I647V probably benign Het
Smyd5 T C 6: 85,440,111 V157A probably benign Het
Syde2 T C 3: 146,002,358 M951T probably benign Het
Tas2r105 T C 6: 131,686,982 N161S probably damaging Het
Tbck T C 3: 132,737,555 F581L probably damaging Het
Traip A G 9: 107,970,017 N352D probably benign Het
Trim29 A G 9: 43,311,609 Y245C probably damaging Het
Trpv4 T C 5: 114,633,140 I443V probably benign Het
Usp36 C T 11: 118,268,834 E595K probably benign Het
Vmn2r51 T A 7: 10,100,553 Y186F probably null Het
Vmn2r97 A G 17: 18,930,286 Y465C probably damaging Het
Wrb A G 16: 96,151,945 I79V possibly damaging Het
Zfp277 A T 12: 40,329,562 H324Q probably damaging Het
Zfp987 A G 4: 146,121,903 D17G probably damaging Het
Other mutations in Olfml3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Olfml3 APN 3 103736982 unclassified probably null
IGL02130:Olfml3 APN 3 103736967 missense probably benign 0.20
R0133:Olfml3 UTSW 3 103737026 unclassified probably null
R0427:Olfml3 UTSW 3 103737014 missense probably benign 0.27
R2130:Olfml3 UTSW 3 103735869 missense probably benign 0.05
R2131:Olfml3 UTSW 3 103735869 missense probably benign 0.05
R2133:Olfml3 UTSW 3 103735869 missense probably benign 0.05
R4688:Olfml3 UTSW 3 103732181 utr 3 prime probably benign
R5211:Olfml3 UTSW 3 103737199 missense probably benign
R5227:Olfml3 UTSW 3 103736421 missense possibly damaging 0.86
R6223:Olfml3 UTSW 3 103736460 missense probably damaging 1.00
R6493:Olfml3 UTSW 3 103736207 missense possibly damaging 0.61
R7128:Olfml3 UTSW 3 103737168 missense probably benign
R7224:Olfml3 UTSW 3 103735860 missense probably damaging 0.99
R7298:Olfml3 UTSW 3 103735860 missense probably damaging 0.99
R7299:Olfml3 UTSW 3 103735860 missense probably damaging 0.99
R7300:Olfml3 UTSW 3 103735860 missense probably damaging 0.99
R7355:Olfml3 UTSW 3 103736079 missense probably damaging 1.00
X0058:Olfml3 UTSW 3 103732116 utr 3 prime probably benign
Predicted Primers PCR Primer
(F):5'- TTCTGCATAAAACAGAGGGGC -3'
(R):5'- TTGTCATCTGTGGGACCCTG -3'

Sequencing Primer
(F):5'- CAGAGGGGCTTGAGAATTTGG -3'
(R):5'- GGGACCCTGTACGTTGTCTATAACAC -3'
Posted On2019-06-26