Incidental Mutation 'R0591:Slc30a4'
ID55959
Institutional Source Beutler Lab
Gene Symbol Slc30a4
Ensembl Gene ENSMUSG00000005802
Gene Namesolute carrier family 30 (zinc transporter), member 4
SynonymsZnt4
MMRRC Submission 038781-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0591 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location122681233-122702663 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 122685240 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 411 (L411H)
Ref Sequence ENSEMBL: ENSMUSP00000005952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005952] [ENSMUST00000099457]
Predicted Effect probably damaging
Transcript: ENSMUST00000005952
AA Change: L411H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005952
Gene: ENSMUSG00000005802
AA Change: L411H

DomainStartEndE-ValueType
low complexity region 67 83 N/A INTRINSIC
Pfam:Cation_efflux 114 333 1.3e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099457
AA Change: L362H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097056
Gene: ENSMUSG00000005802
AA Change: L362H

DomainStartEndE-ValueType
low complexity region 67 83 N/A INTRINSIC
Pfam:Cation_efflux 124 368 4.6e-46 PFAM
Meta Mutation Damage Score 0.0896 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.2%
  • 10x: 97.7%
  • 20x: 95.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc is the second most abundant trace metal in the human body. It is an essential element, serving both a structural role, as in the formation of zinc fingers in DNA-binding proteins, and a catalytic role in metalloenzymes, such as pancreatic carboxypeptidases (e.g., MIM 114852), alkaline phosphatases (e.g., MIM 171760), various dehydrogenases, and superoxide dismutases (e.g., MIM 147450). SLC30A4, or ZNT4, belongs to the ZNT family of zinc transporters. ZNTs are involved in transporting zinc out of the cytoplasm and have similar structures, consisting of 6 transmembrane domains and a histidine-rich cytoplasmic loop (Huang and Gitschier, 1997 [PubMed 9354792]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant dams produce zinc-deficient milk that is lethal to all nursing pups. Pleiotropic defects observed in mutant males and females include otolith degeneration, impaired motor coordination, alopecia, and dermatitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G T 3: 138,068,943 E1298* probably null Het
Adam19 T C 11: 46,121,411 probably benign Het
Agt A T 8: 124,556,939 S480R possibly damaging Het
Anapc1 G T 2: 128,619,332 D1769E probably benign Het
Aox4 T C 1: 58,239,102 probably benign Het
Apol9b G A 15: 77,735,630 V209I possibly damaging Het
Appl2 A T 10: 83,624,645 I116K possibly damaging Het
B230118H07Rik A T 2: 101,576,117 D155E probably benign Het
BC051665 A G 13: 60,784,608 probably benign Het
Cactin G T 10: 81,324,003 E89* probably null Het
Carf G T 1: 60,125,914 probably benign Het
Ccdc167 A G 17: 29,705,261 probably benign Het
Ceacam3 G A 7: 17,151,883 probably null Het
Clca4b T A 3: 144,915,592 K574* probably null Het
Crabp1 T A 9: 54,765,603 I64N probably damaging Het
Dgkd T A 1: 87,915,104 I118N probably damaging Het
Dglucy T C 12: 100,859,518 probably benign Het
Dock10 C T 1: 80,541,219 probably benign Het
Ednrb A T 14: 103,823,274 probably null Het
Ercc6 T C 14: 32,558,016 probably benign Het
Gm5538 C A 3: 59,752,129 Y334* probably null Het
Golga3 A C 5: 110,188,743 Q416P probably damaging Het
Gpr12 A G 5: 146,583,635 V159A probably benign Het
Heatr5a A T 12: 51,910,101 probably benign Het
Helz2 A G 2: 181,232,116 I2195T probably damaging Het
Hikeshi A T 7: 89,920,087 N76K possibly damaging Het
Hsd11b1 T C 1: 193,229,676 probably benign Het
Inhba A T 13: 16,026,820 K322N probably damaging Het
Katnal1 A T 5: 148,892,516 F291L probably damaging Het
Kcnj9 T C 1: 172,323,098 E316G probably damaging Het
Lrsam1 A G 2: 32,933,923 probably benign Het
Mcf2l T G 8: 13,018,751 S1075A probably benign Het
Mios T C 6: 8,215,470 V222A possibly damaging Het
Mycbp2 A T 14: 103,196,391 probably benign Het
Nars A T 18: 64,500,567 I544N probably damaging Het
Olfr993 A G 2: 85,414,690 L63P possibly damaging Het
Pbrm1 A G 14: 31,046,430 probably benign Het
Plcb4 A G 2: 135,955,012 probably benign Het
Pnliprp1 A G 19: 58,734,706 D213G probably damaging Het
Psap A G 10: 60,300,855 N538D possibly damaging Het
Ptdss1 A G 13: 66,972,650 probably benign Het
Rap1b G A 10: 117,818,617 probably benign Het
Rhcg T A 7: 79,594,772 probably benign Het
Ryr1 G A 7: 29,104,795 T550I possibly damaging Het
Samm50 G A 15: 84,211,168 G452R probably benign Het
Scin A G 12: 40,080,930 probably null Het
Sesn3 T C 9: 14,308,558 L81S probably damaging Het
Skint6 A C 4: 112,858,169 probably benign Het
Slc44a5 C T 3: 154,234,145 probably benign Het
Slc4a3 C T 1: 75,549,021 A255V probably damaging Het
Slc9b1 A G 3: 135,382,832 N318S possibly damaging Het
Tcp11l2 A T 10: 84,604,594 H287L probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tnks2 T A 19: 36,872,562 Y605N probably damaging Het
Topbp1 T A 9: 103,349,838 N1490K probably benign Het
Ube4b T G 4: 149,357,577 probably benign Het
Usp4 G A 9: 108,348,029 probably benign Het
Vezf1 A T 11: 88,068,435 probably benign Het
Vmn1r184 A T 7: 26,267,075 D82V probably damaging Het
Other mutations in Slc30a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01524:Slc30a4 APN 2 122702388 missense possibly damaging 0.87
IGL01583:Slc30a4 APN 2 122685217 missense probably benign
IGL01823:Slc30a4 APN 2 122702092 missense probably damaging 1.00
IGL02086:Slc30a4 APN 2 122702027 splice site probably benign
F5770:Slc30a4 UTSW 2 122689538 missense probably benign 0.00
R0060:Slc30a4 UTSW 2 122685184 missense probably benign
R0060:Slc30a4 UTSW 2 122685184 missense probably benign
R0373:Slc30a4 UTSW 2 122689399 missense probably damaging 0.99
R1514:Slc30a4 UTSW 2 122689414 missense probably damaging 1.00
R1552:Slc30a4 UTSW 2 122686016 missense probably benign 0.05
R3847:Slc30a4 UTSW 2 122702272 missense probably damaging 1.00
R4195:Slc30a4 UTSW 2 122685270 missense probably damaging 1.00
R4501:Slc30a4 UTSW 2 122685216 missense probably benign
R5558:Slc30a4 UTSW 2 122686983 missense probably damaging 1.00
R6379:Slc30a4 UTSW 2 122689549 missense probably damaging 1.00
R6393:Slc30a4 UTSW 2 122686046 missense probably damaging 1.00
R7394:Slc30a4 UTSW 2 122685304 missense possibly damaging 0.93
V7580:Slc30a4 UTSW 2 122689538 missense probably benign 0.00
V7581:Slc30a4 UTSW 2 122689538 missense probably benign 0.00
V7582:Slc30a4 UTSW 2 122689538 missense probably benign 0.00
V7583:Slc30a4 UTSW 2 122689538 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGTGCTTGACATGGACACAGC -3'
(R):5'- TGGGCTTAGAAACTGCCTTCTGC -3'

Sequencing Primer
(F):5'- AGCTGTCAGGGACTCCATTAG -3'
(R):5'- CAGTAGAAGGGCTTAAGAGACATC -3'
Posted On2013-07-11