Incidental Mutation 'R7191:Tas2r105'
ID559590
Institutional Source Beutler Lab
Gene Symbol Tas2r105
Ensembl Gene ENSMUSG00000051153
Gene Nametaste receptor, type 2, member 105
SynonymsT2r5, Tas2r5, T2R05, T2R9, mGR05, mt2r5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.048) question?
Stock #R7191 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location131686532-131687495 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 131686982 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 161 (N161S)
Ref Sequence ENSEMBL: ENSMUSP00000058006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053652] [ENSMUST00000072404] [ENSMUST00000080619]
Predicted Effect probably damaging
Transcript: ENSMUST00000053652
AA Change: N161S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000058006
Gene: ENSMUSG00000051153
AA Change: N161S

DomainStartEndE-ValueType
Pfam:TAS2R 1 298 9.4e-109 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072404
SMART Domains Protein: ENSMUSP00000072237
Gene: ENSMUSG00000061977

DomainStartEndE-ValueType
Pfam:TAS2R 1 298 8.3e-102 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080619
SMART Domains Protein: ENSMUSP00000079453
Gene: ENSMUSG00000063478

DomainStartEndE-ValueType
Pfam:TAS2R 1 298 8.1e-104 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (52/52)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation respond normally to a variety of bitter, sweet, umami, salty and sour stimuli but show a striking and selective impairement in their ability to taste cycloheximide (a bitter tastant). In addition, homozygotes are no longer behaviorally averse to cycloheximide. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik T A 16: 21,653,564 I129F probably benign Het
Ank2 T A 3: 126,946,392 T1948S unknown Het
Arap1 T C 7: 101,384,992 C214R probably benign Het
BC024978 G A 7: 27,201,123 A176T probably damaging Het
Ccdc82 C T 9: 13,252,472 Q130* probably null Het
Cfh A C 1: 140,112,567 V597G probably benign Het
Clp1 A T 2: 84,724,146 C226* probably null Het
Cyp39a1 G A 17: 43,731,019 W372* probably null Het
Dchs1 G A 7: 105,765,439 P799S possibly damaging Het
Dmbt1 A T 7: 131,044,520 N167I unknown Het
Dock10 A G 1: 80,540,331 S1310P possibly damaging Het
Fam83h C T 15: 76,003,037 G817D probably damaging Het
Fras1 A G 5: 96,614,912 T758A probably benign Het
Fryl T C 5: 73,072,912 H1634R probably damaging Het
Gcg C G 2: 62,476,839 G126A probably damaging Het
Gm4763 C T 7: 24,723,334 V105I possibly damaging Het
Gm4951 A T 18: 60,246,257 D288V probably benign Het
Gne T C 4: 44,040,266 K633E probably benign Het
Gpr4 T C 7: 19,223,230 V359A probably benign Het
Gprc5c C T 11: 114,868,617 T422M possibly damaging Het
Gria2 C A 3: 80,732,085 V207L probably benign Het
Hid1 T C 11: 115,348,469 *789W probably null Het
Jakmip3 G A 7: 138,989,528 probably null Het
Kin G A 2: 10,091,793 R151Q probably benign Het
Krt16 T C 11: 100,246,658 E407G probably damaging Het
Krt81 T C 15: 101,460,229 D381G probably damaging Het
Lrrc34 C T 3: 30,624,878 G357S possibly damaging Het
Mipol1 A G 12: 57,457,066 Q340R probably benign Het
Mpzl3 T G 9: 45,055,244 M1R probably null Het
Nrcam A G 12: 44,572,244 N852S probably benign Het
Nudcd2 C T 11: 40,736,603 Q117* probably null Het
Nup35 A T 2: 80,658,379 E320V probably damaging Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr477 G A 7: 107,990,646 V94M possibly damaging Het
Pkhd1 T C 1: 20,558,719 H668R probably benign Het
Ptprc T A 1: 138,101,044 D333V probably benign Het
Rdh16 A G 10: 127,813,418 K248E probably benign Het
Samd4b C A 7: 28,414,261 G93V probably benign Het
Scgn A G 13: 23,981,493 I78T probably benign Het
Slfn14 T C 11: 83,276,749 I647V probably benign Het
Smyd5 T C 6: 85,440,111 V157A probably benign Het
Syde2 T C 3: 146,002,358 M951T probably benign Het
Tbck T C 3: 132,737,555 F581L probably damaging Het
Traip A G 9: 107,970,017 N352D probably benign Het
Trim29 A G 9: 43,311,609 Y245C probably damaging Het
Trpv4 T C 5: 114,633,140 I443V probably benign Het
Usp36 C T 11: 118,268,834 E595K probably benign Het
Vmn2r51 T A 7: 10,100,553 Y186F probably null Het
Vmn2r97 A G 17: 18,930,286 Y465C probably damaging Het
Wrb A G 16: 96,151,945 I79V possibly damaging Het
Zfp277 A T 12: 40,329,562 H324Q probably damaging Het
Zfp987 A G 4: 146,121,903 D17G probably damaging Het
Other mutations in Tas2r105
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Tas2r105 APN 6 131687111 missense probably benign 0.02
IGL01148:Tas2r105 APN 6 131686852 missense probably damaging 1.00
IGL02882:Tas2r105 APN 6 131687180 missense possibly damaging 0.95
R0833:Tas2r105 UTSW 6 131687430 missense probably benign 0.01
R0836:Tas2r105 UTSW 6 131687430 missense probably benign 0.01
R1429:Tas2r105 UTSW 6 131686941 missense probably benign 0.01
R2010:Tas2r105 UTSW 6 131687402 missense probably benign 0.41
R2418:Tas2r105 UTSW 6 131687447 missense probably damaging 1.00
R4023:Tas2r105 UTSW 6 131686826 missense probably benign 0.02
R4026:Tas2r105 UTSW 6 131686826 missense probably benign 0.02
R4742:Tas2r105 UTSW 6 131686851 missense probably damaging 1.00
R5497:Tas2r105 UTSW 6 131686842 splice site probably null
R5812:Tas2r105 UTSW 6 131686873 missense possibly damaging 0.95
R7236:Tas2r105 UTSW 6 131686760 missense probably damaging 1.00
R7482:Tas2r105 UTSW 6 131687009 missense probably benign 0.10
R8783:Tas2r105 UTSW 6 131686769 missense possibly damaging 0.92
X0067:Tas2r105 UTSW 6 131687270 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- CTTTCACATGAGCTTCTGTGTTGAG -3'
(R):5'- CACCTGACTGTCTGGTTTGC -3'

Sequencing Primer
(F):5'- GTTGAGGTCTCTGAATCCTGAAACAC -3'
(R):5'- GTTTGCCACCAGCCTAAGC -3'
Posted On2019-06-26