Incidental Mutation 'R7191:Vmn2r51'
ID 559591
Institutional Source Beutler Lab
Gene Symbol Vmn2r51
Ensembl Gene ENSMUSG00000058685
Gene Name vomeronasal 2, receptor 51
Synonyms
MMRRC Submission 045274-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R7191 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 9821125-9839586 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 9834480 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 186 (Y186F)
Ref Sequence ENSEMBL: ENSMUSP00000092459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094863]
AlphaFold L7N215
Predicted Effect probably null
Transcript: ENSMUST00000094863
AA Change: Y186F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092459
Gene: ENSMUSG00000058685
AA Change: Y186F

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 2.4e-31 PFAM
Pfam:NCD3G 512 565 8.1e-21 PFAM
Pfam:7tm_3 598 833 2.7e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik T A 16: 21,472,314 (GRCm39) I129F probably benign Het
Actmap G A 7: 26,900,548 (GRCm39) A176T probably damaging Het
Ank2 T A 3: 126,740,041 (GRCm39) T1948S unknown Het
Arap1 T C 7: 101,034,199 (GRCm39) C214R probably benign Het
Ccdc82 C T 9: 13,252,097 (GRCm39) Q130* probably null Het
Cfh A C 1: 140,040,305 (GRCm39) V597G probably benign Het
Clp1 A T 2: 84,554,490 (GRCm39) C226* probably null Het
Cyp39a1 G A 17: 44,041,910 (GRCm39) W372* probably null Het
Dchs1 G A 7: 105,414,646 (GRCm39) P799S possibly damaging Het
Dmbt1 A T 7: 130,646,250 (GRCm39) N167I unknown Het
Dock10 A G 1: 80,518,048 (GRCm39) S1310P possibly damaging Het
Fam83h C T 15: 75,874,886 (GRCm39) G817D probably damaging Het
Fras1 A G 5: 96,762,771 (GRCm39) T758A probably benign Het
Fryl T C 5: 73,230,255 (GRCm39) H1634R probably damaging Het
Gcg C G 2: 62,307,183 (GRCm39) G126A probably damaging Het
Get1 A G 16: 95,953,145 (GRCm39) I79V possibly damaging Het
Gne T C 4: 44,040,266 (GRCm39) K633E probably benign Het
Gpr4 T C 7: 18,957,155 (GRCm39) V359A probably benign Het
Gprc5c C T 11: 114,759,443 (GRCm39) T422M possibly damaging Het
Gria2 C A 3: 80,639,392 (GRCm39) V207L probably benign Het
Hid1 T C 11: 115,239,295 (GRCm39) *789W probably null Het
Iigp1c A T 18: 60,379,329 (GRCm39) D288V probably benign Het
Jakmip3 G A 7: 138,591,257 (GRCm39) probably null Het
Kin G A 2: 10,096,604 (GRCm39) R151Q probably benign Het
Krt16 T C 11: 100,137,484 (GRCm39) E407G probably damaging Het
Krt81 T C 15: 101,358,110 (GRCm39) D381G probably damaging Het
Lrrc34 C T 3: 30,679,027 (GRCm39) G357S possibly damaging Het
Lypd11 C T 7: 24,422,759 (GRCm39) V105I possibly damaging Het
Mipol1 A G 12: 57,503,852 (GRCm39) Q340R probably benign Het
Mpzl3 T G 9: 44,966,542 (GRCm39) M1R probably null Het
Nrcam A G 12: 44,619,027 (GRCm39) N852S probably benign Het
Nudcd2 C T 11: 40,627,430 (GRCm39) Q117* probably null Het
Nup35 A T 2: 80,488,723 (GRCm39) E320V probably damaging Het
Olfml3 T C 3: 103,643,176 (GRCm39) K402E probably damaging Het
Or5p56 G A 7: 107,589,853 (GRCm39) V94M possibly damaging Het
Pkhd1 T C 1: 20,628,943 (GRCm39) H668R probably benign Het
Ptprc T A 1: 138,028,782 (GRCm39) D333V probably benign Het
Rdh16 A G 10: 127,649,287 (GRCm39) K248E probably benign Het
Samd4b C A 7: 28,113,686 (GRCm39) G93V probably benign Het
Scgn A G 13: 24,165,476 (GRCm39) I78T probably benign Het
Slfn14 T C 11: 83,167,575 (GRCm39) I647V probably benign Het
Smyd5 T C 6: 85,417,093 (GRCm39) V157A probably benign Het
Syde2 T C 3: 145,708,113 (GRCm39) M951T probably benign Het
Tas2r105 T C 6: 131,663,945 (GRCm39) N161S probably damaging Het
Tbck T C 3: 132,443,316 (GRCm39) F581L probably damaging Het
Traip A G 9: 107,847,216 (GRCm39) N352D probably benign Het
Trim29 A G 9: 43,222,906 (GRCm39) Y245C probably damaging Het
Trpv4 T C 5: 114,771,201 (GRCm39) I443V probably benign Het
Usp36 C T 11: 118,159,660 (GRCm39) E595K probably benign Het
Vmn2r97 A G 17: 19,150,548 (GRCm39) Y465C probably damaging Het
Zfp277 A T 12: 40,379,561 (GRCm39) H324Q probably damaging Het
Zfp987 A G 4: 146,058,473 (GRCm39) D17G probably damaging Het
Other mutations in Vmn2r51
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01398:Vmn2r51 APN 7 9,836,341 (GRCm39) missense probably benign
IGL01574:Vmn2r51 APN 7 9,836,381 (GRCm39) missense probably damaging 1.00
IGL01743:Vmn2r51 APN 7 9,834,154 (GRCm39) missense probably damaging 0.98
IGL01820:Vmn2r51 APN 7 9,839,409 (GRCm39) missense probably damaging 1.00
IGL02563:Vmn2r51 APN 7 9,834,243 (GRCm39) missense probably benign 0.00
IGL02825:Vmn2r51 APN 7 9,832,046 (GRCm39) splice site probably benign
IGL02834:Vmn2r51 APN 7 9,832,063 (GRCm39) nonsense probably null
R0617:Vmn2r51 UTSW 7 9,834,396 (GRCm39) missense possibly damaging 0.65
R0967:Vmn2r51 UTSW 7 9,834,012 (GRCm39) missense probably damaging 0.97
R1465:Vmn2r51 UTSW 7 9,834,249 (GRCm39) missense probably damaging 1.00
R1465:Vmn2r51 UTSW 7 9,834,249 (GRCm39) missense probably damaging 1.00
R1559:Vmn2r51 UTSW 7 9,836,373 (GRCm39) missense possibly damaging 0.87
R1559:Vmn2r51 UTSW 7 9,836,372 (GRCm39) missense possibly damaging 0.58
R1598:Vmn2r51 UTSW 7 9,839,432 (GRCm39) missense probably benign
R1754:Vmn2r51 UTSW 7 9,833,873 (GRCm39) missense probably benign 0.04
R1836:Vmn2r51 UTSW 7 9,832,091 (GRCm39) nonsense probably null
R1836:Vmn2r51 UTSW 7 9,832,090 (GRCm39) nonsense probably null
R3151:Vmn2r51 UTSW 7 9,833,968 (GRCm39) missense probably damaging 1.00
R4566:Vmn2r51 UTSW 7 9,836,341 (GRCm39) missense probably benign
R4933:Vmn2r51 UTSW 7 9,832,247 (GRCm39) missense probably damaging 1.00
R5004:Vmn2r51 UTSW 7 9,821,932 (GRCm39) missense probably benign
R5050:Vmn2r51 UTSW 7 9,834,349 (GRCm39) missense probably damaging 0.99
R5510:Vmn2r51 UTSW 7 9,836,545 (GRCm39) missense possibly damaging 0.95
R5559:Vmn2r51 UTSW 7 9,826,128 (GRCm39) missense probably damaging 1.00
R6127:Vmn2r51 UTSW 7 9,839,558 (GRCm39) missense probably damaging 1.00
R6154:Vmn2r51 UTSW 7 9,821,921 (GRCm39) missense possibly damaging 0.74
R6304:Vmn2r51 UTSW 7 9,832,164 (GRCm39) missense probably benign 0.00
R6370:Vmn2r51 UTSW 7 9,832,143 (GRCm39) missense probably damaging 1.00
R6471:Vmn2r51 UTSW 7 9,836,510 (GRCm39) missense possibly damaging 0.48
R6800:Vmn2r51 UTSW 7 9,832,191 (GRCm39) missense probably damaging 0.99
R6883:Vmn2r51 UTSW 7 9,834,025 (GRCm39) missense possibly damaging 0.75
R7246:Vmn2r51 UTSW 7 9,836,428 (GRCm39) missense probably benign 0.00
R8939:Vmn2r51 UTSW 7 9,833,953 (GRCm39) missense possibly damaging 0.85
R9154:Vmn2r51 UTSW 7 9,839,480 (GRCm39) missense probably damaging 0.96
R9428:Vmn2r51 UTSW 7 9,833,712 (GRCm39) critical splice donor site probably benign
R9451:Vmn2r51 UTSW 7 9,833,816 (GRCm39) missense probably damaging 1.00
R9729:Vmn2r51 UTSW 7 9,839,479 (GRCm39) missense probably benign 0.00
R9767:Vmn2r51 UTSW 7 9,839,407 (GRCm39) missense probably benign 0.09
Z1176:Vmn2r51 UTSW 7 9,833,835 (GRCm39) missense probably benign 0.12
Z1176:Vmn2r51 UTSW 7 9,821,984 (GRCm39) missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- AAGTGAAACGTCATCAACAGAGATC -3'
(R):5'- GTGCCAGGCTTCCACATTTG -3'

Sequencing Primer
(F):5'- CGTCATCAACAGAGATCATTTTCAC -3'
(R):5'- AGGCTTCCACATTTGCTAATTTG -3'
Posted On 2019-06-26