Mutagenetix > Incidental Mutations

Incidental Mutation 'R7191:Arap1'

559596

Institutional Source

Beutler Lab

Gene Symbol

Arap1

Ensembl Gene

ENSMUSG00000032812

Gene Name

ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1

Synonyms

Centd2, 2410002L19Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7191 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

101348067-101412586 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 101384992 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 214 (C214R)

Ref Sequence

ENSEMBL: ENSMUSP00000081958 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084895] [ENSMUST00000084896] [ENSMUST00000107010] [ENSMUST00000127873] [ENSMUST00000130016] [ENSMUST00000134143] [ENSMUST00000141083] [ENSMUST00000148902]

Predicted Effect

probably benign
Transcript: ENSMUST00000084895

SMART Domains

Protein: ENSMUSP00000081957
Gene: ENSMUSG00000032812

Domain	Start	End	E-Value	Type
low complexity region	19	37	N/A	INTRINSIC
PH	82	175	2.62e-17	SMART
PH	195	285	3.6e-6	SMART
ArfGap	289	415	2.4e-22	SMART
PH	498	606	1.23e-13	SMART
PH	616	710	1.08e0	SMART
RhoGAP	722	904	1.35e-63	SMART
Pfam:RA	926	1015	1.5e-10	PFAM
PH	1029	1141	8.58e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000084896
AA Change: C214R

PolyPhen 2 Score 0.314 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000081958
Gene: ENSMUSG00000032812
AA Change: C214R

Domain	Start	End	E-Value	Type
SAM	3	70	1.72e-7	SMART
low complexity region	92	104	N/A	INTRINSIC
low complexity region	115	126	N/A	INTRINSIC
low complexity region	135	146	N/A	INTRINSIC
low complexity region	151	167	N/A	INTRINSIC
low complexity region	197	227	N/A	INTRINSIC
low complexity region	267	285	N/A	INTRINSIC
PH	330	423	2.62e-17	SMART
PH	443	533	3.6e-6	SMART
ArfGap	537	663	2.4e-22	SMART
PH	746	854	1.23e-13	SMART
PH	864	958	1.08e0	SMART
RhoGAP	970	1152	1.35e-63	SMART
Pfam:RA	1174	1263	6.6e-13	PFAM
PH	1277	1400	8e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000107010
AA Change: C214R

PolyPhen 2 Score 0.442 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000102624
Gene: ENSMUSG00000032812
AA Change: C214R

Domain	Start	End	E-Value	Type
SAM	3	70	1.72e-7	SMART
low complexity region	92	104	N/A	INTRINSIC
low complexity region	115	126	N/A	INTRINSIC
low complexity region	135	146	N/A	INTRINSIC
low complexity region	151	167	N/A	INTRINSIC
low complexity region	197	227	N/A	INTRINSIC
low complexity region	267	285	N/A	INTRINSIC
PH	330	423	2.62e-17	SMART
PH	443	533	3.6e-6	SMART
ArfGap	537	663	2.4e-22	SMART
PH	746	854	1.23e-13	SMART
PH	864	958	1.08e0	SMART
RhoGAP	970	1152	1.35e-63	SMART
Pfam:RA	1174	1263	1.9e-10	PFAM
PH	1277	1389	8.58e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000127873

SMART Domains

Protein: ENSMUSP00000121257
Gene: ENSMUSG00000032812

Domain	Start	End	E-Value	Type
low complexity region	19	37	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000130016

SMART Domains

Protein: ENSMUSP00000115850
Gene: ENSMUSG00000032812

Domain	Start	End	E-Value	Type
low complexity region	19	37	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000134143

SMART Domains

Protein: ENSMUSP00000115107
Gene: ENSMUSG00000032812

Domain	Start	End	E-Value	Type
low complexity region	19	37	N/A	INTRINSIC
SCOP:d1ki1b2	68	111	4e-4	SMART
Blast:PH	82	111	6e-15	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000141083

Predicted Effect

probably benign
Transcript: ENSMUST00000148902

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains SAM, ARF-GAP, RHO-GAP, ankyrin repeat, RAS-associating, and pleckstrin homology (PH) domains. In vitro, this protein displays RHO-GAP and phosphatidylinositol (3,4,5) trisphosphate (PIP3)-dependent ARF-GAP activity. The encoded protein associates with the Golgi, and the ARF-GAP activity mediates changes in the Golgi and the formation of filopodia. It is thought to regulate the cell-specific trafficking of a receptor protein involved in apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2510009E07Rik	T	A	16: 21,653,564	I129F	probably benign	Het
Ank2	T	A	3: 126,946,392	T1948S	unknown	Het
BC024978	G	A	7: 27,201,123	A176T	probably damaging	Het
Ccdc82	C	T	9: 13,252,472	Q130*	probably null	Het
Cfh	A	C	1: 140,112,567	V597G	probably benign	Het
Clp1	A	T	2: 84,724,146	C226*	probably null	Het
Cyp39a1	G	A	17: 43,731,019	W372*	probably null	Het
Dchs1	G	A	7: 105,765,439	P799S	possibly damaging	Het
Dmbt1	A	T	7: 131,044,520	N167I	unknown	Het
Dock10	A	G	1: 80,540,331	S1310P	possibly damaging	Het
Fam83h	C	T	15: 76,003,037	G817D	probably damaging	Het
Fras1	A	G	5: 96,614,912	T758A	probably benign	Het
Fryl	T	C	5: 73,072,912	H1634R	probably damaging	Het
Gcg	C	G	2: 62,476,839	G126A	probably damaging	Het
Gm4763	C	T	7: 24,723,334	V105I	possibly damaging	Het
Gm4951	A	T	18: 60,246,257	D288V	probably benign	Het
Gne	T	C	4: 44,040,266	K633E	probably benign	Het
Gpr4	T	C	7: 19,223,230	V359A	probably benign	Het
Gprc5c	C	T	11: 114,868,617	T422M	possibly damaging	Het
Gria2	C	A	3: 80,732,085	V207L	probably benign	Het
Hid1	T	C	11: 115,348,469	*789W	probably null	Het
Jakmip3	G	A	7: 138,989,528		probably null	Het
Kin	G	A	2: 10,091,793	R151Q	probably benign	Het
Krt16	T	C	11: 100,246,658	E407G	probably damaging	Het
Krt81	T	C	15: 101,460,229	D381G	probably damaging	Het
Lrrc34	C	T	3: 30,624,878	G357S	possibly damaging	Het
Mipol1	A	G	12: 57,457,066	Q340R	probably benign	Het
Mpzl3	T	G	9: 45,055,244	M1R	probably null	Het
Nrcam	A	G	12: 44,572,244	N852S	probably benign	Het
Nudcd2	C	T	11: 40,736,603	Q117*	probably null	Het
Nup35	A	T	2: 80,658,379	E320V	probably damaging	Het
Olfml3	T	C	3: 103,735,860	K402E	probably damaging	Het
Olfr477	G	A	7: 107,990,646	V94M	possibly damaging	Het
Pkhd1	T	C	1: 20,558,719	H668R	probably benign	Het
Ptprc	T	A	1: 138,101,044	D333V	probably benign	Het
Rdh16	A	G	10: 127,813,418	K248E	probably benign	Het
Samd4b	C	A	7: 28,414,261	G93V	probably benign	Het
Scgn	A	G	13: 23,981,493	I78T	probably benign	Het
Slfn14	T	C	11: 83,276,749	I647V	probably benign	Het
Smyd5	T	C	6: 85,440,111	V157A	probably benign	Het
Syde2	T	C	3: 146,002,358	M951T	probably benign	Het
Tas2r105	T	C	6: 131,686,982	N161S	probably damaging	Het
Tbck	T	C	3: 132,737,555	F581L	probably damaging	Het
Traip	A	G	9: 107,970,017	N352D	probably benign	Het
Trim29	A	G	9: 43,311,609	Y245C	probably damaging	Het
Trpv4	T	C	5: 114,633,140	I443V	probably benign	Het
Usp36	C	T	11: 118,268,834	E595K	probably benign	Het
Vmn2r51	T	A	7: 10,100,553	Y186F	probably null	Het
Vmn2r97	A	G	17: 18,930,286	Y465C	probably damaging	Het
Wrb	A	G	16: 96,151,945	I79V	possibly damaging	Het
Zfp277	A	T	12: 40,329,562	H324Q	probably damaging	Het
Zfp987	A	G	4: 146,121,903	D17G	probably damaging	Het

Other mutations in Arap1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00517:Arap1	APN	7	101388049	missense	probably damaging	0.96
IGL01311:Arap1	APN	7	101388136	nonsense	probably null
IGL01349:Arap1	APN	7	101387152	missense	possibly damaging	0.84
IGL01521:Arap1	APN	7	101400605	critical splice donor site	probably null
IGL01869:Arap1	APN	7	101400283	missense	probably damaging	1.00
IGL02156:Arap1	APN	7	101388730	unclassified	probably benign
IGL02320:Arap1	APN	7	101385029	missense	probably benign
IGL02478:Arap1	APN	7	101400125	splice site	probably null
R0133:Arap1	UTSW	7	101386229	missense	probably damaging	0.98
R0233:Arap1	UTSW	7	101400241	missense	possibly damaging	0.47
R0233:Arap1	UTSW	7	101400241	missense	possibly damaging	0.47
R0412:Arap1	UTSW	7	101390222	missense	probably damaging	0.98
R0616:Arap1	UTSW	7	101401650	missense	possibly damaging	0.64
R0838:Arap1	UTSW	7	101400412	missense	probably damaging	1.00
R0962:Arap1	UTSW	7	101384914	missense	possibly damaging	0.56
R1186:Arap1	UTSW	7	101404269	splice site	probably benign
R1405:Arap1	UTSW	7	101398436	splice site	probably null
R1405:Arap1	UTSW	7	101398436	splice site	probably null
R1724:Arap1	UTSW	7	101400526	missense	possibly damaging	0.91
R1793:Arap1	UTSW	7	101388622	missense	probably benign
R1959:Arap1	UTSW	7	101373015	missense	probably damaging	1.00
R1960:Arap1	UTSW	7	101373015	missense	probably damaging	1.00
R2020:Arap1	UTSW	7	101401518	missense	probably benign	0.00
R2128:Arap1	UTSW	7	101409320	missense	probably damaging	1.00
R3737:Arap1	UTSW	7	101400277	missense	possibly damaging	0.85
R3851:Arap1	UTSW	7	101390165	nonsense	probably null
R4034:Arap1	UTSW	7	101400277	missense	possibly damaging	0.85
R4386:Arap1	UTSW	7	101385571	missense	probably benign
R4435:Arap1	UTSW	7	101390254	missense	possibly damaging	0.74
R4779:Arap1	UTSW	7	101404367	missense	probably damaging	1.00
R4786:Arap1	UTSW	7	101385005	missense	possibly damaging	0.94
R4850:Arap1	UTSW	7	101398791	missense	probably damaging	1.00
R4942:Arap1	UTSW	7	101401802	missense	possibly damaging	0.95
R5253:Arap1	UTSW	7	101388644	missense	probably benign	0.00
R5342:Arap1	UTSW	7	101404960	missense	probably benign	0.00
R5367:Arap1	UTSW	7	101409130	missense	probably damaging	0.99
R5397:Arap1	UTSW	7	101384912	missense	possibly damaging	0.95
R5968:Arap1	UTSW	7	101394738	missense	probably damaging	1.00
R6052:Arap1	UTSW	7	101404033	missense	probably damaging	1.00
R6574:Arap1	UTSW	7	101404001	missense	probably damaging	1.00
R6645:Arap1	UTSW	7	101408111	missense	possibly damaging	0.57
R7060:Arap1	UTSW	7	101409357	splice site	probably null
R7323:Arap1	UTSW	7	101400211	missense	probably damaging	1.00
R7349:Arap1	UTSW	7	101390228	missense	possibly damaging	0.95
R7516:Arap1	UTSW	7	101409331	missense	probably benign	0.00
R8034:Arap1	UTSW	7	101394773	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGCTTGCCTAGTGAGCAG -3'
(R):5'- AAAGGACGTGCTCTTTGAGAAG -3'

Sequencing Primer
(F):5'- TAGTGAGCAGGGCCTCAGTG -3'
(R):5'- GCTCTTTGAGAAGGCTTACGACAC -3'

Posted On

2019-06-26