Incidental Mutation 'R7191:Rdh16'
ID 559604
Institutional Source Beutler Lab
Gene Symbol Rdh16
Ensembl Gene ENSMUSG00000069456
Gene Name retinol dehydrogenase 16
Synonyms Rdh6, cis-retinol/androgen dehydrogenase 1, CRAD1
MMRRC Submission 045274-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7191 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 127636959-127651715 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 127649287 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 248 (K248E)
Ref Sequence ENSEMBL: ENSMUSP00000071573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071646] [ENSMUST00000125163] [ENSMUST00000155739]
AlphaFold O54909
Predicted Effect probably benign
Transcript: ENSMUST00000071646
AA Change: K248E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000071573
Gene: ENSMUSG00000069456
AA Change: K248E

DomainStartEndE-ValueType
Pfam:adh_short 30 220 5.9e-42 PFAM
Pfam:DUF1776 43 303 1.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125163
Predicted Effect probably benign
Transcript: ENSMUST00000155739
SMART Domains Protein: ENSMUSP00000115993
Gene: ENSMUSG00000069456

DomainStartEndE-ValueType
Pfam:adh_short 30 107 3.3e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik T A 16: 21,472,314 (GRCm39) I129F probably benign Het
Actmap G A 7: 26,900,548 (GRCm39) A176T probably damaging Het
Ank2 T A 3: 126,740,041 (GRCm39) T1948S unknown Het
Arap1 T C 7: 101,034,199 (GRCm39) C214R probably benign Het
Ccdc82 C T 9: 13,252,097 (GRCm39) Q130* probably null Het
Cfh A C 1: 140,040,305 (GRCm39) V597G probably benign Het
Clp1 A T 2: 84,554,490 (GRCm39) C226* probably null Het
Cyp39a1 G A 17: 44,041,910 (GRCm39) W372* probably null Het
Dchs1 G A 7: 105,414,646 (GRCm39) P799S possibly damaging Het
Dmbt1 A T 7: 130,646,250 (GRCm39) N167I unknown Het
Dock10 A G 1: 80,518,048 (GRCm39) S1310P possibly damaging Het
Fam83h C T 15: 75,874,886 (GRCm39) G817D probably damaging Het
Fras1 A G 5: 96,762,771 (GRCm39) T758A probably benign Het
Fryl T C 5: 73,230,255 (GRCm39) H1634R probably damaging Het
Gcg C G 2: 62,307,183 (GRCm39) G126A probably damaging Het
Get1 A G 16: 95,953,145 (GRCm39) I79V possibly damaging Het
Gne T C 4: 44,040,266 (GRCm39) K633E probably benign Het
Gpr4 T C 7: 18,957,155 (GRCm39) V359A probably benign Het
Gprc5c C T 11: 114,759,443 (GRCm39) T422M possibly damaging Het
Gria2 C A 3: 80,639,392 (GRCm39) V207L probably benign Het
Hid1 T C 11: 115,239,295 (GRCm39) *789W probably null Het
Iigp1c A T 18: 60,379,329 (GRCm39) D288V probably benign Het
Jakmip3 G A 7: 138,591,257 (GRCm39) probably null Het
Kin G A 2: 10,096,604 (GRCm39) R151Q probably benign Het
Krt16 T C 11: 100,137,484 (GRCm39) E407G probably damaging Het
Krt81 T C 15: 101,358,110 (GRCm39) D381G probably damaging Het
Lrrc34 C T 3: 30,679,027 (GRCm39) G357S possibly damaging Het
Lypd11 C T 7: 24,422,759 (GRCm39) V105I possibly damaging Het
Mipol1 A G 12: 57,503,852 (GRCm39) Q340R probably benign Het
Mpzl3 T G 9: 44,966,542 (GRCm39) M1R probably null Het
Nrcam A G 12: 44,619,027 (GRCm39) N852S probably benign Het
Nudcd2 C T 11: 40,627,430 (GRCm39) Q117* probably null Het
Nup35 A T 2: 80,488,723 (GRCm39) E320V probably damaging Het
Olfml3 T C 3: 103,643,176 (GRCm39) K402E probably damaging Het
Or5p56 G A 7: 107,589,853 (GRCm39) V94M possibly damaging Het
Pkhd1 T C 1: 20,628,943 (GRCm39) H668R probably benign Het
Ptprc T A 1: 138,028,782 (GRCm39) D333V probably benign Het
Samd4b C A 7: 28,113,686 (GRCm39) G93V probably benign Het
Scgn A G 13: 24,165,476 (GRCm39) I78T probably benign Het
Slfn14 T C 11: 83,167,575 (GRCm39) I647V probably benign Het
Smyd5 T C 6: 85,417,093 (GRCm39) V157A probably benign Het
Syde2 T C 3: 145,708,113 (GRCm39) M951T probably benign Het
Tas2r105 T C 6: 131,663,945 (GRCm39) N161S probably damaging Het
Tbck T C 3: 132,443,316 (GRCm39) F581L probably damaging Het
Traip A G 9: 107,847,216 (GRCm39) N352D probably benign Het
Trim29 A G 9: 43,222,906 (GRCm39) Y245C probably damaging Het
Trpv4 T C 5: 114,771,201 (GRCm39) I443V probably benign Het
Usp36 C T 11: 118,159,660 (GRCm39) E595K probably benign Het
Vmn2r51 T A 7: 9,834,480 (GRCm39) Y186F probably null Het
Vmn2r97 A G 17: 19,150,548 (GRCm39) Y465C probably damaging Het
Zfp277 A T 12: 40,379,561 (GRCm39) H324Q probably damaging Het
Zfp987 A G 4: 146,058,473 (GRCm39) D17G probably damaging Het
Other mutations in Rdh16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Rdh16 APN 10 127,649,365 (GRCm39) missense probably benign 0.01
IGL01618:Rdh16 APN 10 127,637,176 (GRCm39) missense probably damaging 1.00
IGL02125:Rdh16 APN 10 127,647,188 (GRCm39) intron probably benign
IGL02820:Rdh16 APN 10 127,649,470 (GRCm39) missense probably benign 0.01
IGL03091:Rdh16 APN 10 127,649,502 (GRCm39) utr 3 prime probably benign
R1674:Rdh16 UTSW 10 127,637,226 (GRCm39) missense probably benign 0.25
R4616:Rdh16 UTSW 10 127,637,382 (GRCm39) splice site probably null
R4675:Rdh16 UTSW 10 127,637,316 (GRCm39) missense probably damaging 1.00
R5324:Rdh16 UTSW 10 127,637,136 (GRCm39) missense probably damaging 0.99
R7935:Rdh16 UTSW 10 127,637,334 (GRCm39) missense probably benign 0.04
R9263:Rdh16 UTSW 10 127,649,306 (GRCm39) missense probably benign
X0013:Rdh16 UTSW 10 127,637,199 (GRCm39) missense probably damaging 1.00
X0066:Rdh16 UTSW 10 127,637,199 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAGCACTCTCTATGAGCTAAG -3'
(R):5'- CAGTAGAGAAGGGCATCCAC -3'

Sequencing Primer
(F):5'- CACTCTCTATGAGCTAAGATGGG -3'
(R):5'- GGGCATCCACAAGAAAGGTG -3'
Posted On 2019-06-26