Mutagenetix > Incidental Mutations

Incidental Mutation 'R7191:Gprc5c'

559608

Institutional Source

Beutler Lab

Gene Symbol

Gprc5c

Ensembl Gene

ENSMUSG00000051043

Gene Name

G protein-coupled receptor, family C, group 5, member C

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.302) question?

Stock #

R7191 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

114851152-114872617 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 114868617 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 422 (T422M)

Ref Sequence

ENSEMBL: ENSMUSP00000061760 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021071] [ENSMUST00000053361] [ENSMUST00000122967] [ENSMUST00000133245] [ENSMUST00000136785] [ENSMUST00000142262] [ENSMUST00000152314] [ENSMUST00000177952]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000021071
AA Change: T422M

PolyPhen 2 Score 0.833 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000021071
Gene: ENSMUSG00000051043
AA Change: T422M

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:7tm_3	58	302	1.3e-42	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000053361
AA Change: T422M

PolyPhen 2 Score 0.560 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000061760
Gene: ENSMUSG00000051043
AA Change: T422M

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:7tm_3	60	301	1.3e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000122967

SMART Domains

Protein: ENSMUSP00000114335
Gene: ENSMUSG00000051043

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
transmembrane domain	55	77	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000133245

SMART Domains

Protein: ENSMUSP00000121572
Gene: ENSMUSG00000051043

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
transmembrane domain	55	77	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000136785

SMART Domains

Protein: ENSMUSP00000116786
Gene: ENSMUSG00000051043

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:7tm_3	58	283	1.5e-38	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000142262

SMART Domains

Protein: ENSMUSP00000121524
Gene: ENSMUSG00000051043

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:7tm_3	58	133	6.2e-14	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000152314
AA Change: T91M

PolyPhen 2 Score 0.560 (Sensitivity: 0.88; Specificity: 0.91)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000177952
AA Change: T422M

PolyPhen 2 Score 0.833 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000136702
Gene: ENSMUSG00000051043
AA Change: T422M

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:7tm_3	58	302	1.3e-42	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the type 3 G protein-coupled receptor family. Members of this superfamily are characterized by a signature 7-transmembrane domain motif. The specific function of this protein is unknown; however, this protein may mediate the cellular effects of retinoic acid on the G protein signal transduction cascade. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele are behaviorally normal but exhibit reticulocytosis, increased mean corpuscular volume, increased percentage of basophils, decreased mean corpuscular hemogloblin concentration, and increased alkaline phophatase and lactic dehydrogenase levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2510009E07Rik	T	A	16: 21,653,564	I129F	probably benign	Het
Ank2	T	A	3: 126,946,392	T1948S	unknown	Het
Arap1	T	C	7: 101,384,992	C214R	probably benign	Het
BC024978	G	A	7: 27,201,123	A176T	probably damaging	Het
Ccdc82	C	T	9: 13,252,472	Q130*	probably null	Het
Cfh	A	C	1: 140,112,567	V597G	probably benign	Het
Clp1	A	T	2: 84,724,146	C226*	probably null	Het
Cyp39a1	G	A	17: 43,731,019	W372*	probably null	Het
Dchs1	G	A	7: 105,765,439	P799S	possibly damaging	Het
Dmbt1	A	T	7: 131,044,520	N167I	unknown	Het
Dock10	A	G	1: 80,540,331	S1310P	possibly damaging	Het
Fam83h	C	T	15: 76,003,037	G817D	probably damaging	Het
Fras1	A	G	5: 96,614,912	T758A	probably benign	Het
Fryl	T	C	5: 73,072,912	H1634R	probably damaging	Het
Gcg	C	G	2: 62,476,839	G126A	probably damaging	Het
Gm4763	C	T	7: 24,723,334	V105I	possibly damaging	Het
Gm4951	A	T	18: 60,246,257	D288V	probably benign	Het
Gne	T	C	4: 44,040,266	K633E	probably benign	Het
Gpr4	T	C	7: 19,223,230	V359A	probably benign	Het
Gria2	C	A	3: 80,732,085	V207L	probably benign	Het
Hid1	T	C	11: 115,348,469	*789W	probably null	Het
Jakmip3	G	A	7: 138,989,528		probably null	Het
Kin	G	A	2: 10,091,793	R151Q	probably benign	Het
Krt16	T	C	11: 100,246,658	E407G	probably damaging	Het
Krt81	T	C	15: 101,460,229	D381G	probably damaging	Het
Lrrc34	C	T	3: 30,624,878	G357S	possibly damaging	Het
Mipol1	A	G	12: 57,457,066	Q340R	probably benign	Het
Mpzl3	T	G	9: 45,055,244	M1R	probably null	Het
Nrcam	A	G	12: 44,572,244	N852S	probably benign	Het
Nudcd2	C	T	11: 40,736,603	Q117*	probably null	Het
Nup35	A	T	2: 80,658,379	E320V	probably damaging	Het
Olfml3	T	C	3: 103,735,860	K402E	probably damaging	Het
Olfr477	G	A	7: 107,990,646	V94M	possibly damaging	Het
Pkhd1	T	C	1: 20,558,719	H668R	probably benign	Het
Ptprc	T	A	1: 138,101,044	D333V	probably benign	Het
Rdh16	A	G	10: 127,813,418	K248E	probably benign	Het
Samd4b	C	A	7: 28,414,261	G93V	probably benign	Het
Scgn	A	G	13: 23,981,493	I78T	probably benign	Het
Slfn14	T	C	11: 83,276,749	I647V	probably benign	Het
Smyd5	T	C	6: 85,440,111	V157A	probably benign	Het
Syde2	T	C	3: 146,002,358	M951T	probably benign	Het
Tas2r105	T	C	6: 131,686,982	N161S	probably damaging	Het
Tbck	T	C	3: 132,737,555	F581L	probably damaging	Het
Traip	A	G	9: 107,970,017	N352D	probably benign	Het
Trim29	A	G	9: 43,311,609	Y245C	probably damaging	Het
Trpv4	T	C	5: 114,633,140	I443V	probably benign	Het
Usp36	C	T	11: 118,268,834	E595K	probably benign	Het
Vmn2r51	T	A	7: 10,100,553	Y186F	probably null	Het
Vmn2r97	A	G	17: 18,930,286	Y465C	probably damaging	Het
Wrb	A	G	16: 96,151,945	I79V	possibly damaging	Het
Zfp277	A	T	12: 40,329,562	H324Q	probably damaging	Het
Zfp987	A	G	4: 146,121,903	D17G	probably damaging	Het

Other mutations in Gprc5c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01599:Gprc5c	APN	11	114864252	missense	probably benign	0.01
IGL01762:Gprc5c	APN	11	114864024	missense	probably benign	0.28
IGL02039:Gprc5c	APN	11	114864486	nonsense	probably null
R0800:Gprc5c	UTSW	11	114866711	missense	probably damaging	0.99
R1618:Gprc5c	UTSW	11	114864394	missense	possibly damaging	0.88
R4198:Gprc5c	UTSW	11	114863860	missense	probably damaging	1.00
R4807:Gprc5c	UTSW	11	114864498	missense	probably damaging	0.97
R4846:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R4902:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R4904:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5016:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5048:Gprc5c	UTSW	11	114870351	makesense	probably null
R5106:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5109:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5173:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5266:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5267:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5475:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5508:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5557:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5562:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5563:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5598:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5599:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5729:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5756:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5792:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5793:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5794:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5817:Gprc5c	UTSW	11	114863624	nonsense	probably null
R5976:Gprc5c	UTSW	11	114864487	missense	possibly damaging	0.89
R6151:Gprc5c	UTSW	11	114864025	missense	probably damaging	1.00
R6617:Gprc5c	UTSW	11	114864105	missense	probably benign	0.05
R7108:Gprc5c	UTSW	11	114864282	missense	probably damaging	1.00
R7796:Gprc5c	UTSW	11	114864532	missense	probably damaging	0.97
R8543:Gprc5c	UTSW	11	114864268	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATTTGTGCATTTGCCCTGGC -3'
(R):5'- AACATCAGCAGATCAGGGGC -3'

Sequencing Primer
(F):5'- ATTTGCCCTGGCGGAAC -3'
(R):5'- TCTGACCCTGAGGCATAAGC -3'

Posted On

2019-06-26