Incidental Mutation 'R7191:Hid1'
ID559609
Institutional Source Beutler Lab
Gene Symbol Hid1
Ensembl Gene ENSMUSG00000034586
Gene NameHID1 domain containing
SynonymsC630004H02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R7191 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location115347707-115367756 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 115348469 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 789 (*789W)
Ref Sequence ENSEMBL: ENSMUSP00000102152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019006] [ENSMUST00000044152] [ENSMUST00000106542] [ENSMUST00000106543]
Predicted Effect probably benign
Transcript: ENSMUST00000019006
SMART Domains Protein: ENSMUSP00000019006
Gene: ENSMUSG00000018862

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 102 120 N/A INTRINSIC
Pfam:Otopetrin 142 483 3e-40 PFAM
Pfam:Otopetrin 506 583 1.2e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000044152
AA Change: *788W
SMART Domains Protein: ENSMUSP00000043789
Gene: ENSMUSG00000034586
AA Change: *788W

DomainStartEndE-ValueType
Pfam:Dymeclin 1 763 3.9e-242 PFAM
Pfam:Hid1 1 784 3.1e-260 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106542
AA Change: *789W
SMART Domains Protein: ENSMUSP00000102152
Gene: ENSMUSG00000034586
AA Change: *789W

DomainStartEndE-ValueType
Pfam:Dymeclin 1 764 7.5e-275 PFAM
Pfam:Hid1 1 785 2.3e-261 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106543
SMART Domains Protein: ENSMUSP00000102153
Gene: ENSMUSG00000018862

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 102 120 N/A INTRINSIC
transmembrane domain 141 163 N/A INTRINSIC
transmembrane domain 178 195 N/A INTRINSIC
transmembrane domain 208 227 N/A INTRINSIC
Pfam:Otopetrin 241 462 2.1e-20 PFAM
Pfam:Otopetrin 487 564 2.2e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik T A 16: 21,653,564 I129F probably benign Het
Ank2 T A 3: 126,946,392 T1948S unknown Het
Arap1 T C 7: 101,384,992 C214R probably benign Het
BC024978 G A 7: 27,201,123 A176T probably damaging Het
Ccdc82 C T 9: 13,252,472 Q130* probably null Het
Cfh A C 1: 140,112,567 V597G probably benign Het
Clp1 A T 2: 84,724,146 C226* probably null Het
Cyp39a1 G A 17: 43,731,019 W372* probably null Het
Dchs1 G A 7: 105,765,439 P799S possibly damaging Het
Dmbt1 A T 7: 131,044,520 N167I unknown Het
Dock10 A G 1: 80,540,331 S1310P possibly damaging Het
Fam83h C T 15: 76,003,037 G817D probably damaging Het
Fras1 A G 5: 96,614,912 T758A probably benign Het
Fryl T C 5: 73,072,912 H1634R probably damaging Het
Gcg C G 2: 62,476,839 G126A probably damaging Het
Gm4763 C T 7: 24,723,334 V105I possibly damaging Het
Gm4951 A T 18: 60,246,257 D288V probably benign Het
Gne T C 4: 44,040,266 K633E probably benign Het
Gpr4 T C 7: 19,223,230 V359A probably benign Het
Gprc5c C T 11: 114,868,617 T422M possibly damaging Het
Gria2 C A 3: 80,732,085 V207L probably benign Het
Jakmip3 G A 7: 138,989,528 probably null Het
Kin G A 2: 10,091,793 R151Q probably benign Het
Krt16 T C 11: 100,246,658 E407G probably damaging Het
Krt81 T C 15: 101,460,229 D381G probably damaging Het
Lrrc34 C T 3: 30,624,878 G357S possibly damaging Het
Mipol1 A G 12: 57,457,066 Q340R probably benign Het
Mpzl3 T G 9: 45,055,244 M1R probably null Het
Nrcam A G 12: 44,572,244 N852S probably benign Het
Nudcd2 C T 11: 40,736,603 Q117* probably null Het
Nup35 A T 2: 80,658,379 E320V probably damaging Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr477 G A 7: 107,990,646 V94M possibly damaging Het
Pkhd1 T C 1: 20,558,719 H668R probably benign Het
Ptprc T A 1: 138,101,044 D333V probably benign Het
Rdh16 A G 10: 127,813,418 K248E probably benign Het
Samd4b C A 7: 28,414,261 G93V probably benign Het
Scgn A G 13: 23,981,493 I78T probably benign Het
Slfn14 T C 11: 83,276,749 I647V probably benign Het
Smyd5 T C 6: 85,440,111 V157A probably benign Het
Syde2 T C 3: 146,002,358 M951T probably benign Het
Tas2r105 T C 6: 131,686,982 N161S probably damaging Het
Tbck T C 3: 132,737,555 F581L probably damaging Het
Traip A G 9: 107,970,017 N352D probably benign Het
Trim29 A G 9: 43,311,609 Y245C probably damaging Het
Trpv4 T C 5: 114,633,140 I443V probably benign Het
Usp36 C T 11: 118,268,834 E595K probably benign Het
Vmn2r51 T A 7: 10,100,553 Y186F probably null Het
Vmn2r97 A G 17: 18,930,286 Y465C probably damaging Het
Wrb A G 16: 96,151,945 I79V possibly damaging Het
Zfp277 A T 12: 40,329,562 H324Q probably damaging Het
Zfp987 A G 4: 146,121,903 D17G probably damaging Het
Other mutations in Hid1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Hid1 APN 11 115359069 missense probably benign 0.05
IGL00783:Hid1 APN 11 115348510 missense probably damaging 1.00
IGL00935:Hid1 APN 11 115348498 missense probably damaging 1.00
IGL02081:Hid1 APN 11 115348506 missense possibly damaging 0.94
IGL02383:Hid1 APN 11 115352620 missense probably damaging 1.00
IGL02637:Hid1 APN 11 115350595 missense probably damaging 0.97
IGL03174:Hid1 APN 11 115360389 missense probably damaging 1.00
R0124:Hid1 UTSW 11 115356823 missense probably damaging 1.00
R0533:Hid1 UTSW 11 115348809 missense probably damaging 1.00
R1027:Hid1 UTSW 11 115355425 missense probably damaging 1.00
R1069:Hid1 UTSW 11 115356765 missense probably damaging 1.00
R1171:Hid1 UTSW 11 115352717 missense probably benign
R1583:Hid1 UTSW 11 115356750 missense possibly damaging 0.51
R1689:Hid1 UTSW 11 115360357 missense probably damaging 1.00
R1746:Hid1 UTSW 11 115354638 missense probably damaging 0.98
R1772:Hid1 UTSW 11 115348473 missense probably damaging 0.97
R1773:Hid1 UTSW 11 115348510 missense probably damaging 1.00
R1831:Hid1 UTSW 11 115348903 missense probably damaging 1.00
R2234:Hid1 UTSW 11 115351119 missense probably damaging 1.00
R2235:Hid1 UTSW 11 115351119 missense probably damaging 1.00
R2897:Hid1 UTSW 11 115350530 missense probably benign
R2898:Hid1 UTSW 11 115350530 missense probably benign
R3711:Hid1 UTSW 11 115358775 missense probably damaging 1.00
R4059:Hid1 UTSW 11 115356739 missense probably damaging 1.00
R4394:Hid1 UTSW 11 115367642 utr 5 prime probably benign
R4478:Hid1 UTSW 11 115361655 missense probably damaging 1.00
R4552:Hid1 UTSW 11 115358679 missense possibly damaging 0.94
R4822:Hid1 UTSW 11 115355299 missense probably damaging 1.00
R5691:Hid1 UTSW 11 115348819 missense probably damaging 1.00
R5980:Hid1 UTSW 11 115350948 missense possibly damaging 0.64
R5981:Hid1 UTSW 11 115350948 missense possibly damaging 0.64
R6363:Hid1 UTSW 11 115352596 missense probably damaging 1.00
R6577:Hid1 UTSW 11 115354636 missense possibly damaging 0.89
R7307:Hid1 UTSW 11 115348482 missense probably damaging 1.00
R7484:Hid1 UTSW 11 115352581 splice site probably null
R7485:Hid1 UTSW 11 115354719 missense probably damaging 1.00
R7836:Hid1 UTSW 11 115358995 missense probably damaging 0.96
R7883:Hid1 UTSW 11 115354609 missense probably damaging 1.00
R7904:Hid1 UTSW 11 115355361 missense probably damaging 1.00
X0025:Hid1 UTSW 11 115348803 nonsense probably null
X0066:Hid1 UTSW 11 115354725 missense probably damaging 1.00
Z1177:Hid1 UTSW 11 115352725 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGAGGCTCCTAGAACAGC -3'
(R):5'- TACCCAGAGTGAGGCATCAG -3'

Sequencing Primer
(F):5'- TCCTAGAACAGCCTGGAGG -3'
(R):5'- CCAGAGTGAGGCATCAGGTTGG -3'
Posted On2019-06-26