Incidental Mutation 'R7191:Zfp277'
ID559611
Institutional Source Beutler Lab
Gene Symbol Zfp277
Ensembl Gene ENSMUSG00000055917
Gene Namezinc finger protein 277
Synonyms2410017E24Rik, NIRF4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R7191 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location40315046-40445902 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 40329562 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 324 (H324Q)
Ref Sequence ENSEMBL: ENSMUSP00000064226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069637] [ENSMUST00000069692]
Predicted Effect probably damaging
Transcript: ENSMUST00000069637
AA Change: H198Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068032
Gene: ENSMUSG00000055917
AA Change: H198Q

DomainStartEndE-ValueType
ZnF_C2H2 59 84 4.27e1 SMART
coiled coil region 143 171 N/A INTRINSIC
ZnF_C2H2 174 198 3.85e1 SMART
ZnF_C2H2 225 249 2.24e-3 SMART
low complexity region 280 292 N/A INTRINSIC
ZnF_C2H2 303 326 1.91e1 SMART
ZnF_C2H2 356 382 4.94e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000069692
AA Change: H324Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064226
Gene: ENSMUSG00000055917
AA Change: H324Q

DomainStartEndE-ValueType
ZnF_C2H2 185 210 4.27e1 SMART
coiled coil region 269 297 N/A INTRINSIC
ZnF_C2H2 300 324 3.85e1 SMART
ZnF_C2H2 351 375 2.24e-3 SMART
low complexity region 406 418 N/A INTRINSIC
ZnF_C2H2 429 452 1.91e1 SMART
ZnF_C2H2 482 508 4.94e0 SMART
Meta Mutation Damage Score 0.9574 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (52/52)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit early cellular preplicative senescence in MEFs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik T A 16: 21,653,564 I129F probably benign Het
Ank2 T A 3: 126,946,392 T1948S unknown Het
Arap1 T C 7: 101,384,992 C214R probably benign Het
BC024978 G A 7: 27,201,123 A176T probably damaging Het
Ccdc82 C T 9: 13,252,472 Q130* probably null Het
Cfh A C 1: 140,112,567 V597G probably benign Het
Clp1 A T 2: 84,724,146 C226* probably null Het
Cyp39a1 G A 17: 43,731,019 W372* probably null Het
Dchs1 G A 7: 105,765,439 P799S possibly damaging Het
Dmbt1 A T 7: 131,044,520 N167I unknown Het
Dock10 A G 1: 80,540,331 S1310P possibly damaging Het
Fam83h C T 15: 76,003,037 G817D probably damaging Het
Fras1 A G 5: 96,614,912 T758A probably benign Het
Fryl T C 5: 73,072,912 H1634R probably damaging Het
Gcg C G 2: 62,476,839 G126A probably damaging Het
Gm4763 C T 7: 24,723,334 V105I possibly damaging Het
Gm4951 A T 18: 60,246,257 D288V probably benign Het
Gne T C 4: 44,040,266 K633E probably benign Het
Gpr4 T C 7: 19,223,230 V359A probably benign Het
Gprc5c C T 11: 114,868,617 T422M possibly damaging Het
Gria2 C A 3: 80,732,085 V207L probably benign Het
Hid1 T C 11: 115,348,469 *789W probably null Het
Jakmip3 G A 7: 138,989,528 probably null Het
Kin G A 2: 10,091,793 R151Q probably benign Het
Krt16 T C 11: 100,246,658 E407G probably damaging Het
Krt81 T C 15: 101,460,229 D381G probably damaging Het
Lrrc34 C T 3: 30,624,878 G357S possibly damaging Het
Mipol1 A G 12: 57,457,066 Q340R probably benign Het
Mpzl3 T G 9: 45,055,244 M1R probably null Het
Nrcam A G 12: 44,572,244 N852S probably benign Het
Nudcd2 C T 11: 40,736,603 Q117* probably null Het
Nup35 A T 2: 80,658,379 E320V probably damaging Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr477 G A 7: 107,990,646 V94M possibly damaging Het
Pkhd1 T C 1: 20,558,719 H668R probably benign Het
Ptprc T A 1: 138,101,044 D333V probably benign Het
Rdh16 A G 10: 127,813,418 K248E probably benign Het
Samd4b C A 7: 28,414,261 G93V probably benign Het
Scgn A G 13: 23,981,493 I78T probably benign Het
Slfn14 T C 11: 83,276,749 I647V probably benign Het
Smyd5 T C 6: 85,440,111 V157A probably benign Het
Syde2 T C 3: 146,002,358 M951T probably benign Het
Tas2r105 T C 6: 131,686,982 N161S probably damaging Het
Tbck T C 3: 132,737,555 F581L probably damaging Het
Traip A G 9: 107,970,017 N352D probably benign Het
Trim29 A G 9: 43,311,609 Y245C probably damaging Het
Trpv4 T C 5: 114,633,140 I443V probably benign Het
Usp36 C T 11: 118,268,834 E595K probably benign Het
Vmn2r51 T A 7: 10,100,553 Y186F probably null Het
Vmn2r97 A G 17: 18,930,286 Y465C probably damaging Het
Wrb A G 16: 96,151,945 I79V possibly damaging Het
Zfp987 A G 4: 146,121,903 D17G probably damaging Het
Other mutations in Zfp277
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01466:Zfp277 APN 12 40378826 missense probably benign 0.24
IGL01477:Zfp277 APN 12 40320676 missense probably benign 0.00
IGL02081:Zfp277 APN 12 40328796 nonsense probably null
IGL02165:Zfp277 APN 12 40315803 missense possibly damaging 0.75
IGL02613:Zfp277 APN 12 40329515 missense probably damaging 1.00
IGL02688:Zfp277 APN 12 40328688 missense possibly damaging 0.95
IGL02825:Zfp277 APN 12 40317176 missense probably benign 0.06
R0194:Zfp277 UTSW 12 40378877 splice site probably benign
R0226:Zfp277 UTSW 12 40364162 missense possibly damaging 0.67
R0843:Zfp277 UTSW 12 40320600 critical splice donor site probably null
R1263:Zfp277 UTSW 12 40364165 missense probably damaging 0.99
R1584:Zfp277 UTSW 12 40378826 missense probably benign 0.12
R1609:Zfp277 UTSW 12 40328720 missense probably damaging 0.99
R1644:Zfp277 UTSW 12 40329610 splice site probably null
R1789:Zfp277 UTSW 12 40364085 missense probably benign 0.00
R1882:Zfp277 UTSW 12 40445746 missense probably benign 0.03
R2011:Zfp277 UTSW 12 40317218 nonsense probably null
R4884:Zfp277 UTSW 12 40363153 missense probably damaging 0.97
R4976:Zfp277 UTSW 12 40328688 missense possibly damaging 0.95
R5119:Zfp277 UTSW 12 40328688 missense possibly damaging 0.95
R5532:Zfp277 UTSW 12 40335309 missense probably damaging 1.00
R6340:Zfp277 UTSW 12 40318549 missense possibly damaging 0.57
R7378:Zfp277 UTSW 12 40315853 missense possibly damaging 0.94
R7446:Zfp277 UTSW 12 40328730 missense probably damaging 1.00
R7564:Zfp277 UTSW 12 40329595 missense probably damaging 0.99
R7861:Zfp277 UTSW 12 40315881 missense possibly damaging 0.92
R8428:Zfp277 UTSW 12 40329578 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTCAATGTTTGGCATAAAGC -3'
(R):5'- CATAGCCATCTTAGCGAGGCTC -3'

Sequencing Primer
(F):5'- AGGGTAAAATCCCACAGT -3'
(R):5'- CATCTTAGCGAGGCTCAAGTG -3'
Posted On2019-06-26