Incidental Mutation 'R7191:Mipol1'
ID 559613
Institutional Source Beutler Lab
Gene Symbol Mipol1
Ensembl Gene ENSMUSG00000047022
Gene Name mirror-image polydactyly 1
Synonyms 1700081O04Rik, 6030439O22Rik, D12Ertd19e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7191 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 57230427-57497199 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 57457066 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 340 (Q340R)
Ref Sequence ENSEMBL: ENSMUSP00000121617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123498] [ENSMUST00000130447] [ENSMUST00000145003] [ENSMUST00000153137]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000123498
AA Change: Q340R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000119636
Gene: ENSMUSG00000047022
AA Change: Q340R

DomainStartEndE-ValueType
coiled coil region 70 127 N/A INTRINSIC
Blast:HNHc 220 265 2e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000130447
AA Change: Q340R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000119918
Gene: ENSMUSG00000047022
AA Change: Q340R

DomainStartEndE-ValueType
coiled coil region 70 127 N/A INTRINSIC
Blast:HNHc 220 265 2e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000145003
AA Change: Q340R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000121617
Gene: ENSMUSG00000047022
AA Change: Q340R

DomainStartEndE-ValueType
coiled coil region 70 127 N/A INTRINSIC
Blast:HNHc 220 265 2e-15 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000153137
AA Change: Q340R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000117005
Gene: ENSMUSG00000047022
AA Change: Q340R

DomainStartEndE-ValueType
coiled coil region 70 127 N/A INTRINSIC
Blast:HNHc 220 265 2e-15 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain-containing protein. The encoded protein may function as a tumor suppressor. A translocation that results in truncation of the protein encoded by this locus has been associated with mirror-image polydactyly, also known as Laurin-Sandrow Syndrome. Alternatively spliced transcript variants have been described. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik T A 16: 21,653,564 I129F probably benign Het
Ank2 T A 3: 126,946,392 T1948S unknown Het
Arap1 T C 7: 101,384,992 C214R probably benign Het
BC024978 G A 7: 27,201,123 A176T probably damaging Het
Ccdc82 C T 9: 13,252,472 Q130* probably null Het
Cfh A C 1: 140,112,567 V597G probably benign Het
Clp1 A T 2: 84,724,146 C226* probably null Het
Cyp39a1 G A 17: 43,731,019 W372* probably null Het
Dchs1 G A 7: 105,765,439 P799S possibly damaging Het
Dmbt1 A T 7: 131,044,520 N167I unknown Het
Dock10 A G 1: 80,540,331 S1310P possibly damaging Het
Fam83h C T 15: 76,003,037 G817D probably damaging Het
Fras1 A G 5: 96,614,912 T758A probably benign Het
Fryl T C 5: 73,072,912 H1634R probably damaging Het
Gcg C G 2: 62,476,839 G126A probably damaging Het
Gm4763 C T 7: 24,723,334 V105I possibly damaging Het
Gm4951 A T 18: 60,246,257 D288V probably benign Het
Gne T C 4: 44,040,266 K633E probably benign Het
Gpr4 T C 7: 19,223,230 V359A probably benign Het
Gprc5c C T 11: 114,868,617 T422M possibly damaging Het
Gria2 C A 3: 80,732,085 V207L probably benign Het
Hid1 T C 11: 115,348,469 *789W probably null Het
Jakmip3 G A 7: 138,989,528 probably null Het
Kin G A 2: 10,091,793 R151Q probably benign Het
Krt16 T C 11: 100,246,658 E407G probably damaging Het
Krt81 T C 15: 101,460,229 D381G probably damaging Het
Lrrc34 C T 3: 30,624,878 G357S possibly damaging Het
Mpzl3 T G 9: 45,055,244 M1R probably null Het
Nrcam A G 12: 44,572,244 N852S probably benign Het
Nudcd2 C T 11: 40,736,603 Q117* probably null Het
Nup35 A T 2: 80,658,379 E320V probably damaging Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr477 G A 7: 107,990,646 V94M possibly damaging Het
Pkhd1 T C 1: 20,558,719 H668R probably benign Het
Ptprc T A 1: 138,101,044 D333V probably benign Het
Rdh16 A G 10: 127,813,418 K248E probably benign Het
Samd4b C A 7: 28,414,261 G93V probably benign Het
Scgn A G 13: 23,981,493 I78T probably benign Het
Slfn14 T C 11: 83,276,749 I647V probably benign Het
Smyd5 T C 6: 85,440,111 V157A probably benign Het
Syde2 T C 3: 146,002,358 M951T probably benign Het
Tas2r105 T C 6: 131,686,982 N161S probably damaging Het
Tbck T C 3: 132,737,555 F581L probably damaging Het
Traip A G 9: 107,970,017 N352D probably benign Het
Trim29 A G 9: 43,311,609 Y245C probably damaging Het
Trpv4 T C 5: 114,633,140 I443V probably benign Het
Usp36 C T 11: 118,268,834 E595K probably benign Het
Vmn2r51 T A 7: 10,100,553 Y186F probably null Het
Vmn2r97 A G 17: 18,930,286 Y465C probably damaging Het
Wrb A G 16: 96,151,945 I79V possibly damaging Het
Zfp277 A T 12: 40,329,562 H324Q probably damaging Het
Zfp987 A G 4: 146,121,903 D17G probably damaging Het
Other mutations in Mipol1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Mipol1 APN 12 57307353 splice site probably benign
IGL01139:Mipol1 APN 12 57306035 nonsense probably null
IGL02679:Mipol1 APN 12 57306043 missense possibly damaging 0.84
IGL03109:Mipol1 APN 12 57364224 missense probably benign 0.20
R0001:Mipol1 UTSW 12 57460839 splice site probably benign
R0220:Mipol1 UTSW 12 57457150 missense probably damaging 1.00
R0271:Mipol1 UTSW 12 57460954 unclassified probably benign
R0284:Mipol1 UTSW 12 57457069 missense probably damaging 0.98
R0496:Mipol1 UTSW 12 57457177 missense probably damaging 0.99
R0538:Mipol1 UTSW 12 57414411 critical splice donor site probably null
R1082:Mipol1 UTSW 12 57325616 missense probably damaging 0.98
R1552:Mipol1 UTSW 12 57306088 missense possibly damaging 0.86
R1558:Mipol1 UTSW 12 57332341 missense probably damaging 1.00
R1928:Mipol1 UTSW 12 57332419 missense probably damaging 1.00
R2104:Mipol1 UTSW 12 57306056 splice site probably null
R2495:Mipol1 UTSW 12 57460990 splice site probably benign
R3723:Mipol1 UTSW 12 57457092 missense probably damaging 1.00
R4431:Mipol1 UTSW 12 57303524 missense possibly damaging 0.58
R4447:Mipol1 UTSW 12 57352748 intron probably benign
R4654:Mipol1 UTSW 12 57306132 missense probably benign 0.22
R4847:Mipol1 UTSW 12 57303496 missense probably damaging 0.99
R4851:Mipol1 UTSW 12 57332301 missense probably damaging 1.00
R5113:Mipol1 UTSW 12 57496499 missense probably benign 0.36
R5668:Mipol1 UTSW 12 57325560 missense possibly damaging 0.48
R6535:Mipol1 UTSW 12 57306100 missense possibly damaging 0.95
R7172:Mipol1 UTSW 12 57325535 missense possibly damaging 0.95
R7560:Mipol1 UTSW 12 57306073 missense possibly damaging 0.94
R8508:Mipol1 UTSW 12 57306088 missense possibly damaging 0.86
R8752:Mipol1 UTSW 12 57325581 missense probably damaging 1.00
R8772:Mipol1 UTSW 12 57325632 missense probably benign 0.23
R8861:Mipol1 UTSW 12 57306016 missense probably benign 0.00
R8928:Mipol1 UTSW 12 57460865 missense probably benign 0.00
R9011:Mipol1 UTSW 12 57457079 missense probably benign 0.03
R9250:Mipol1 UTSW 12 57414383 missense probably damaging 1.00
R9383:Mipol1 UTSW 12 57306034 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTAGAAGAGGGGTTTCACATGAAG -3'
(R):5'- AAAACTATGTGGACTGTTGGGTTTC -3'

Sequencing Primer
(F):5'- TCTCAGCTTGCACAAATC -3'
(R):5'- TCATGCCTTTAGGGTCAG -3'
Posted On 2019-06-26