Incidental Mutation 'R7191:Cyp39a1'
ID559620
Institutional Source Beutler Lab
Gene Symbol Cyp39a1
Ensembl Gene ENSMUSG00000023963
Gene Namecytochrome P450, family 39, subfamily a, polypeptide 1
Synonymsoxysterol 7-alpha-hydroxylase
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R7191 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location43667425-43751431 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 43731019 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 372 (W372*)
Ref Sequence ENSEMBL: ENSMUSP00000130073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170988]
Predicted Effect probably null
Transcript: ENSMUST00000170988
AA Change: W372*
SMART Domains Protein: ENSMUSP00000130073
Gene: ENSMUSG00000023963
AA Change: W372*

DomainStartEndE-ValueType
Pfam:p450 32 464 1.9e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum protein is involved in the conversion of cholesterol to bile acids. Its substrates include the oxysterols 25-hydroxycholesterol, 27-hydroxycholesterol and 24-hydroxycholesterol. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik T A 16: 21,653,564 I129F probably benign Het
Ank2 T A 3: 126,946,392 T1948S unknown Het
Arap1 T C 7: 101,384,992 C214R probably benign Het
BC024978 G A 7: 27,201,123 A176T probably damaging Het
Ccdc82 C T 9: 13,252,472 Q130* probably null Het
Cfh A C 1: 140,112,567 V597G probably benign Het
Clp1 A T 2: 84,724,146 C226* probably null Het
Dchs1 G A 7: 105,765,439 P799S possibly damaging Het
Dmbt1 A T 7: 131,044,520 N167I unknown Het
Dock10 A G 1: 80,540,331 S1310P possibly damaging Het
Fam83h C T 15: 76,003,037 G817D probably damaging Het
Fras1 A G 5: 96,614,912 T758A probably benign Het
Fryl T C 5: 73,072,912 H1634R probably damaging Het
Gcg C G 2: 62,476,839 G126A probably damaging Het
Gm4763 C T 7: 24,723,334 V105I possibly damaging Het
Gm4951 A T 18: 60,246,257 D288V probably benign Het
Gne T C 4: 44,040,266 K633E probably benign Het
Gpr4 T C 7: 19,223,230 V359A probably benign Het
Gprc5c C T 11: 114,868,617 T422M possibly damaging Het
Gria2 C A 3: 80,732,085 V207L probably benign Het
Hid1 T C 11: 115,348,469 *789W probably null Het
Jakmip3 G A 7: 138,989,528 probably null Het
Kin G A 2: 10,091,793 R151Q probably benign Het
Krt16 T C 11: 100,246,658 E407G probably damaging Het
Krt81 T C 15: 101,460,229 D381G probably damaging Het
Lrrc34 C T 3: 30,624,878 G357S possibly damaging Het
Mipol1 A G 12: 57,457,066 Q340R probably benign Het
Mpzl3 T G 9: 45,055,244 M1R probably null Het
Nrcam A G 12: 44,572,244 N852S probably benign Het
Nudcd2 C T 11: 40,736,603 Q117* probably null Het
Nup35 A T 2: 80,658,379 E320V probably damaging Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr477 G A 7: 107,990,646 V94M possibly damaging Het
Pkhd1 T C 1: 20,558,719 H668R probably benign Het
Ptprc T A 1: 138,101,044 D333V probably benign Het
Rdh16 A G 10: 127,813,418 K248E probably benign Het
Samd4b C A 7: 28,414,261 G93V probably benign Het
Scgn A G 13: 23,981,493 I78T probably benign Het
Slfn14 T C 11: 83,276,749 I647V probably benign Het
Smyd5 T C 6: 85,440,111 V157A probably benign Het
Syde2 T C 3: 146,002,358 M951T probably benign Het
Tas2r105 T C 6: 131,686,982 N161S probably damaging Het
Tbck T C 3: 132,737,555 F581L probably damaging Het
Traip A G 9: 107,970,017 N352D probably benign Het
Trim29 A G 9: 43,311,609 Y245C probably damaging Het
Trpv4 T C 5: 114,633,140 I443V probably benign Het
Usp36 C T 11: 118,268,834 E595K probably benign Het
Vmn2r51 T A 7: 10,100,553 Y186F probably null Het
Vmn2r97 A G 17: 18,930,286 Y465C probably damaging Het
Wrb A G 16: 96,151,945 I79V possibly damaging Het
Zfp277 A T 12: 40,329,562 H324Q probably damaging Het
Zfp987 A G 4: 146,121,903 D17G probably damaging Het
Other mutations in Cyp39a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Cyp39a1 APN 17 43701543 missense probably benign 0.01
IGL01070:Cyp39a1 APN 17 43683022 missense probably benign 0.00
IGL01606:Cyp39a1 APN 17 43746618 splice site probably benign
IGL01769:Cyp39a1 APN 17 43749915 missense possibly damaging 0.53
IGL01916:Cyp39a1 APN 17 43731050 missense probably damaging 1.00
IGL02374:Cyp39a1 APN 17 43749981 utr 3 prime probably benign
IGL02402:Cyp39a1 APN 17 43691722 missense probably benign 0.07
IGL03097:Cyp39a1 UTSW 17 43683050 nonsense probably null
R0230:Cyp39a1 UTSW 17 43732012 missense probably damaging 1.00
R1244:Cyp39a1 UTSW 17 43749945 missense probably benign 0.13
R1572:Cyp39a1 UTSW 17 43680129 missense probably damaging 1.00
R1656:Cyp39a1 UTSW 17 43667619 missense possibly damaging 0.74
R4036:Cyp39a1 UTSW 17 43676940 missense probably damaging 0.97
R4308:Cyp39a1 UTSW 17 43730964 splice site probably null
R5081:Cyp39a1 UTSW 17 43746597 missense probably damaging 1.00
R5197:Cyp39a1 UTSW 17 43746538 missense possibly damaging 0.67
R5405:Cyp39a1 UTSW 17 43676940 missense probably damaging 1.00
R5566:Cyp39a1 UTSW 17 43685208 missense possibly damaging 0.92
R5578:Cyp39a1 UTSW 17 43680140 missense possibly damaging 0.91
R6045:Cyp39a1 UTSW 17 43731991 missense probably damaging 1.00
R6495:Cyp39a1 UTSW 17 43691694 missense probably benign 0.41
R7431:Cyp39a1 UTSW 17 43683015 missense probably benign
R7522:Cyp39a1 UTSW 17 43667479 start gained probably benign
R7620:Cyp39a1 UTSW 17 43725653 splice site probably null
R8022:Cyp39a1 UTSW 17 43746577 missense probably damaging 1.00
R8143:Cyp39a1 UTSW 17 43725626 missense probably benign 0.39
Z1176:Cyp39a1 UTSW 17 43725577 missense probably benign 0.01
Z1176:Cyp39a1 UTSW 17 43731048 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGACCTAGCCAGGAAACTTAG -3'
(R):5'- AATCCTACCGGTCTGTCGTC -3'

Sequencing Primer
(F):5'- GCCAGGAAACTTAGTTATTTTCTCAC -3'
(R):5'- GGCAATTCTGGGCACAGTTAC -3'
Posted On2019-06-26