Incidental Mutation 'R7192:Trabd2b'
ID559645
Institutional Source Beutler Lab
Gene Symbol Trabd2b
Ensembl Gene ENSMUSG00000070867
Gene NameTraB domain containing 2B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R7192 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location114406724-114615098 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 114610020 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 482 (Q482L)
Ref Sequence ENSEMBL: ENSMUSP00000092494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094894]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094894
AA Change: Q482L

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000092494
Gene: ENSMUSG00000070867
AA Change: Q482L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:TraB 41 350 6.2e-67 PFAM
low complexity region 359 402 N/A INTRINSIC
low complexity region 404 419 N/A INTRINSIC
low complexity region 450 469 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (72/74)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik G A 2: 30,796,176 T329I probably damaging Het
Actl6a C A 3: 32,720,224 P290H probably damaging Het
Akap9 T A 5: 4,005,723 probably null Het
Bach1 C T 16: 87,729,663 S671L possibly damaging Het
Cacna1c T C 6: 118,656,249 I1099V Het
Cage1 G T 13: 38,019,244 P615T probably benign Het
Caskin2 C A 11: 115,801,376 R861L probably damaging Het
Cc2d2b A G 19: 40,774,437 T386A unknown Het
Ccndbp1 A G 2: 121,012,943 D272G probably damaging Het
Cep192 T A 18: 67,850,528 V1553E probably damaging Het
Chrm5 C T 2: 112,480,327 G148D probably damaging Het
Cntnap4 T C 8: 112,881,800 V1284A probably benign Het
Cpd T C 11: 76,814,841 Y355C probably damaging Het
Csmd3 C T 15: 47,704,237 V1266I Het
Cyfip2 T C 11: 46,254,666 E609G probably benign Het
Dbr1 T C 9: 99,576,702 probably null Het
Dmxl1 T C 18: 49,955,853 Y2800H probably damaging Het
Dnajc6 G T 4: 101,597,803 A64S probably benign Het
Dpp8 A T 9: 65,045,786 N248I possibly damaging Het
Dsp A T 13: 38,195,593 I2105F probably benign Het
Edem1 G A 6: 108,829,004 V89M probably benign Het
Eml4 A G 17: 83,454,461 Q528R probably benign Het
Epb42 A T 2: 121,024,097 V669D unknown Het
Fat4 A T 3: 38,980,464 Q2755L probably benign Het
Gata6 A G 18: 11,054,475 K135E possibly damaging Het
Gm36079 T A 13: 120,026,705 K103* probably null Het
Gm4788 T A 1: 139,739,295 H414L probably damaging Het
Gmeb1 A T 4: 132,227,890 F325I probably benign Het
H2-M10.3 C T 17: 36,366,559 E276K probably damaging Het
Hist1h4m A T 13: 21,812,057 K92* probably null Het
Ifi207 T C 1: 173,729,018 N718S not run Het
Il6st A G 13: 112,495,207 N427D probably benign Het
Kat7 T A 11: 95,275,830 M509L probably benign Het
Klk1b4 T C 7: 44,209,621 V21A probably benign Het
Malt1 T A 18: 65,437,827 L78Q probably benign Het
Mertk A G 2: 128,793,108 probably null Het
Myo1b A G 1: 51,757,217 L1016P probably damaging Het
Neu4 A G 1: 94,025,141 I411V probably benign Het
Nutm2 A T 13: 50,473,069 D420V probably damaging Het
Olfr1364 A G 13: 21,574,369 L29P probably damaging Het
Olfr1404 T A 1: 173,216,008 M119K probably damaging Het
Olfr206 T C 16: 59,345,179 D174G probably benign Het
Olfr728 T C 14: 50,140,120 E173G possibly damaging Het
Pcdha12 C T 18: 37,020,263 R12W probably benign Het
Pdgfra G T 5: 75,183,106 D763Y probably damaging Het
Pkd2 T C 5: 104,486,657 V518A probably benign Het
Prb1 G T 6: 132,207,372 P433T unknown Het
Ptrh2 A G 11: 86,690,009 T151A probably damaging Het
Qars T A 9: 108,511,561 N273K probably damaging Het
Robo2 T C 16: 73,920,750 Y1154C probably benign Het
Rps6kc1 T A 1: 190,800,359 D482V probably damaging Het
Sec16b T C 1: 157,529,443 S74P probably benign Het
Serpinb2 A T 1: 107,524,576 I295F probably damaging Het
Sh3pxd2b T A 11: 32,414,318 D301E probably damaging Het
Sipa1l2 G A 8: 125,422,609 T1637I probably benign Het
Slc27a4 A T 2: 29,805,929 N159Y probably damaging Het
Stat1 A C 1: 52,135,621 K161Q possibly damaging Het
Stc2 T C 11: 31,369,872 probably benign Het
Strip1 A G 3: 107,615,335 W681R possibly damaging Het
Sv2a G A 3: 96,193,746 G687S probably damaging Het
Thnsl2 C T 6: 71,139,755 V138I probably benign Het
Tmco3 G A 8: 13,319,605 probably null Het
Tnfrsf1a T C 6: 125,361,596 S235P unknown Het
Tpbg T A 9: 85,844,032 L18* probably null Het
Trim35 T A 14: 66,297,446 F126Y probably damaging Het
Ttn A T 2: 76,827,944 V12364D unknown Het
Ubac2 A G 14: 121,973,716 Y166C probably damaging Het
Unc13b T A 4: 43,258,519 V1320D probably damaging Het
Usp34 T A 11: 23,460,571 Y2693N Het
Utp20 A T 10: 88,772,459 M1572K probably benign Het
Vmn1r7 C T 6: 57,024,467 M269I probably benign Het
Vmn2r3 C T 3: 64,259,943 G589D probably benign Het
Vrtn A T 12: 84,648,862 M129L probably damaging Het
Zfp273 A T 13: 67,825,064 T104S possibly damaging Het
Zfp384 T A 6: 125,033,312 N390K probably damaging Het
Znfx1 A G 2: 167,042,190 M933T probably benign Het
Other mutations in Trabd2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Trabd2b APN 4 114409125 missense probably damaging 0.99
IGL01404:Trabd2b APN 4 114599956 missense probably benign 0.01
IGL01866:Trabd2b APN 4 114408920 missense probably damaging 0.96
IGL03056:Trabd2b APN 4 114409338 missense probably damaging 0.96
IGL03167:Trabd2b APN 4 114609998 missense probably benign
E0374:Trabd2b UTSW 4 114599897 missense probably damaging 0.99
R0645:Trabd2b UTSW 4 114586570 missense probably damaging 1.00
R0744:Trabd2b UTSW 4 114580322 missense probably benign 0.00
R0833:Trabd2b UTSW 4 114580322 missense probably benign 0.00
R1580:Trabd2b UTSW 4 114580334 missense possibly damaging 0.91
R1599:Trabd2b UTSW 4 114408981 missense probably damaging 0.99
R2132:Trabd2b UTSW 4 114610008 missense probably benign
R2133:Trabd2b UTSW 4 114610008 missense probably benign
R2204:Trabd2b UTSW 4 114602994 missense probably damaging 1.00
R2518:Trabd2b UTSW 4 114599903 missense probably damaging 1.00
R4940:Trabd2b UTSW 4 114408944 missense probably damaging 1.00
R4994:Trabd2b UTSW 4 114406855 missense probably benign 0.05
R5104:Trabd2b UTSW 4 114406917 missense probably benign 0.21
R5219:Trabd2b UTSW 4 114602810 missense probably damaging 0.97
R6456:Trabd2b UTSW 4 114586560 missense probably damaging 1.00
R7148:Trabd2b UTSW 4 114409350 missense probably damaging 1.00
R7195:Trabd2b UTSW 4 114409440 missense probably damaging 1.00
R7375:Trabd2b UTSW 4 114609997 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCCTAAGGTACCTGCTAAAAC -3'
(R):5'- CTGTGTGAACTGCCTTGAGG -3'

Sequencing Primer
(F):5'- GGTACCTGCTAAAACTAGAGCTG -3'
(R):5'- ACTGCCTTGAGGGTGTTAGCAC -3'
Posted On2019-06-26