Incidental Mutation 'R7192:Utp20'
ID559663
Institutional Source Beutler Lab
Gene Symbol Utp20
Ensembl Gene ENSMUSG00000004356
Gene NameUTP20 small subunit processome component
Synonyms3830408P06Rik, DRIM, mDRIM
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R7192 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location88746607-88826804 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88772459 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1572 (M1572K)
Ref Sequence ENSEMBL: ENSMUSP00000004470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004470]
Predicted Effect probably benign
Transcript: ENSMUST00000004470
AA Change: M1572K

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000004470
Gene: ENSMUSG00000004356
AA Change: M1572K

DomainStartEndE-ValueType
low complexity region 244 255 N/A INTRINSIC
low complexity region 442 454 N/A INTRINSIC
low complexity region 571 581 N/A INTRINSIC
low complexity region 695 704 N/A INTRINSIC
Pfam:DRIM 910 1534 2.6e-176 PFAM
low complexity region 1585 1598 N/A INTRINSIC
low complexity region 1705 1719 N/A INTRINSIC
low complexity region 2503 2513 N/A INTRINSIC
low complexity region 2589 2605 N/A INTRINSIC
low complexity region 2727 2737 N/A INTRINSIC
low complexity region 2746 2764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219662
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UTP20 is a component of the U3 small nucleolar RNA (snoRNA) (SNORD3A; MIM 180710) protein complex (U3 snoRNP) and is involved in 18S rRNA processing (Wang et al., 2007 [PubMed 17498821]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik G A 2: 30,796,176 T329I probably damaging Het
Actl6a C A 3: 32,720,224 P290H probably damaging Het
Akap9 T A 5: 4,005,723 probably null Het
Bach1 C T 16: 87,729,663 S671L possibly damaging Het
Cacna1c T C 6: 118,656,249 I1099V Het
Cage1 G T 13: 38,019,244 P615T probably benign Het
Caskin2 C A 11: 115,801,376 R861L probably damaging Het
Cc2d2b A G 19: 40,774,437 T386A unknown Het
Ccndbp1 A G 2: 121,012,943 D272G probably damaging Het
Cep192 T A 18: 67,850,528 V1553E probably damaging Het
Chrm5 C T 2: 112,480,327 G148D probably damaging Het
Cntnap4 T C 8: 112,881,800 V1284A probably benign Het
Cpd T C 11: 76,814,841 Y355C probably damaging Het
Csmd3 C T 15: 47,704,237 V1266I Het
Cyfip2 T C 11: 46,254,666 E609G probably benign Het
Dbr1 T C 9: 99,576,702 probably null Het
Dmxl1 T C 18: 49,955,853 Y2800H probably damaging Het
Dnajc6 G T 4: 101,597,803 A64S probably benign Het
Dpp8 A T 9: 65,045,786 N248I possibly damaging Het
Dsp A T 13: 38,195,593 I2105F probably benign Het
Edem1 G A 6: 108,829,004 V89M probably benign Het
Eml4 A G 17: 83,454,461 Q528R probably benign Het
Epb42 A T 2: 121,024,097 V669D unknown Het
Fat4 A T 3: 38,980,464 Q2755L probably benign Het
Gata6 A G 18: 11,054,475 K135E possibly damaging Het
Gm36079 T A 13: 120,026,705 K103* probably null Het
Gm4788 T A 1: 139,739,295 H414L probably damaging Het
Gmeb1 A T 4: 132,227,890 F325I probably benign Het
H2-M10.3 C T 17: 36,366,559 E276K probably damaging Het
Hist1h4m A T 13: 21,812,057 K92* probably null Het
Ifi207 T C 1: 173,729,018 N718S not run Het
Il6st A G 13: 112,495,207 N427D probably benign Het
Kat7 T A 11: 95,275,830 M509L probably benign Het
Klk1b4 T C 7: 44,209,621 V21A probably benign Het
Malt1 T A 18: 65,437,827 L78Q probably benign Het
Mertk A G 2: 128,793,108 probably null Het
Myo1b A G 1: 51,757,217 L1016P probably damaging Het
Neu4 A G 1: 94,025,141 I411V probably benign Het
Nutm2 A T 13: 50,473,069 D420V probably damaging Het
Olfr1364 A G 13: 21,574,369 L29P probably damaging Het
Olfr1404 T A 1: 173,216,008 M119K probably damaging Het
Olfr206 T C 16: 59,345,179 D174G probably benign Het
Olfr728 T C 14: 50,140,120 E173G possibly damaging Het
Pcdha12 C T 18: 37,020,263 R12W probably benign Het
Pdgfra G T 5: 75,183,106 D763Y probably damaging Het
Pkd2 T C 5: 104,486,657 V518A probably benign Het
Prb1 G T 6: 132,207,372 P433T unknown Het
Ptrh2 A G 11: 86,690,009 T151A probably damaging Het
Qars T A 9: 108,511,561 N273K probably damaging Het
Robo2 T C 16: 73,920,750 Y1154C probably benign Het
Rps6kc1 T A 1: 190,800,359 D482V probably damaging Het
Sec16b T C 1: 157,529,443 S74P probably benign Het
Serpinb2 A T 1: 107,524,576 I295F probably damaging Het
Sh3pxd2b T A 11: 32,414,318 D301E probably damaging Het
Sipa1l2 G A 8: 125,422,609 T1637I probably benign Het
Slc27a4 A T 2: 29,805,929 N159Y probably damaging Het
Stat1 A C 1: 52,135,621 K161Q possibly damaging Het
Stc2 T C 11: 31,369,872 probably benign Het
Strip1 A G 3: 107,615,335 W681R possibly damaging Het
Sv2a G A 3: 96,193,746 G687S probably damaging Het
Thnsl2 C T 6: 71,139,755 V138I probably benign Het
Tmco3 G A 8: 13,319,605 probably null Het
Tnfrsf1a T C 6: 125,361,596 S235P unknown Het
Tpbg T A 9: 85,844,032 L18* probably null Het
Trabd2b A T 4: 114,610,020 Q482L possibly damaging Het
Trim35 T A 14: 66,297,446 F126Y probably damaging Het
Ttn A T 2: 76,827,944 V12364D unknown Het
Ubac2 A G 14: 121,973,716 Y166C probably damaging Het
Unc13b T A 4: 43,258,519 V1320D probably damaging Het
Usp34 T A 11: 23,460,571 Y2693N Het
Vmn1r7 C T 6: 57,024,467 M269I probably benign Het
Vmn2r3 C T 3: 64,259,943 G589D probably benign Het
Vrtn A T 12: 84,648,862 M129L probably damaging Het
Zfp273 A T 13: 67,825,064 T104S possibly damaging Het
Zfp384 T A 6: 125,033,312 N390K probably damaging Het
Znfx1 A G 2: 167,042,190 M933T probably benign Het
Other mutations in Utp20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Utp20 APN 10 88825444 missense possibly damaging 0.90
IGL00858:Utp20 APN 10 88809125 missense possibly damaging 0.69
IGL00858:Utp20 APN 10 88809138 missense probably benign
IGL00946:Utp20 APN 10 88748315 missense possibly damaging 0.82
IGL01061:Utp20 APN 10 88770704 missense probably benign 0.13
IGL01399:Utp20 APN 10 88758302 critical splice donor site probably null
IGL01548:Utp20 APN 10 88764781 missense probably damaging 1.00
IGL01587:Utp20 APN 10 88787535 missense probably damaging 0.98
IGL01789:Utp20 APN 10 88798279 critical splice donor site probably null
IGL01819:Utp20 APN 10 88792687 missense probably damaging 1.00
IGL02070:Utp20 APN 10 88821877 splice site probably benign
IGL02231:Utp20 APN 10 88791168 missense probably damaging 1.00
IGL02244:Utp20 APN 10 88815956 splice site probably benign
IGL02367:Utp20 APN 10 88771853 unclassified probably benign
IGL02553:Utp20 APN 10 88764795 missense probably damaging 0.99
IGL02748:Utp20 APN 10 88817295 missense probably benign 0.00
IGL02831:Utp20 APN 10 88815908 missense probably benign
IGL02986:Utp20 APN 10 88775285 missense probably damaging 1.00
IGL02997:Utp20 APN 10 88814034 missense probably benign
IGL03105:Utp20 APN 10 88791096 missense probably benign 0.10
IGL03251:Utp20 APN 10 88817326 critical splice acceptor site probably null
IGL03337:Utp20 APN 10 88754566 missense probably benign
IGL03348:Utp20 APN 10 88758317 missense probably benign 0.09
IGL03381:Utp20 APN 10 88822005 missense probably damaging 0.99
R0037:Utp20 UTSW 10 88798404 missense probably benign 0.05
R0107:Utp20 UTSW 10 88778391 missense probably benign 0.03
R0197:Utp20 UTSW 10 88777516 missense probably benign 0.22
R0219:Utp20 UTSW 10 88764675 missense probably damaging 1.00
R0315:Utp20 UTSW 10 88807421 missense probably damaging 1.00
R0328:Utp20 UTSW 10 88767107 missense possibly damaging 0.82
R0329:Utp20 UTSW 10 88817979 missense probably benign 0.00
R0330:Utp20 UTSW 10 88817979 missense probably benign 0.00
R0395:Utp20 UTSW 10 88818595 missense probably damaging 1.00
R0399:Utp20 UTSW 10 88820979 missense probably damaging 1.00
R0454:Utp20 UTSW 10 88822069 missense probably benign 0.00
R0456:Utp20 UTSW 10 88754573 missense possibly damaging 0.92
R0491:Utp20 UTSW 10 88760912 missense probably damaging 1.00
R0557:Utp20 UTSW 10 88748311 missense probably damaging 0.99
R0600:Utp20 UTSW 10 88767461 missense probably damaging 1.00
R0616:Utp20 UTSW 10 88770751 missense probably benign 0.14
R1076:Utp20 UTSW 10 88772459 missense probably benign 0.36
R1076:Utp20 UTSW 10 88772543 missense possibly damaging 0.86
R1330:Utp20 UTSW 10 88801189 missense probably damaging 0.96
R1440:Utp20 UTSW 10 88819339 missense probably benign 0.19
R1529:Utp20 UTSW 10 88753006 missense probably damaging 1.00
R1554:Utp20 UTSW 10 88764737 nonsense probably null
R1621:Utp20 UTSW 10 88762871 missense probably benign
R1641:Utp20 UTSW 10 88757972 missense possibly damaging 0.82
R1709:Utp20 UTSW 10 88749297 missense probably benign 0.29
R1734:Utp20 UTSW 10 88767461 missense probably damaging 1.00
R1755:Utp20 UTSW 10 88809769 missense probably benign 0.01
R1775:Utp20 UTSW 10 88770808 missense probably benign
R1866:Utp20 UTSW 10 88762770 nonsense probably null
R1867:Utp20 UTSW 10 88749443 missense probably benign
R1901:Utp20 UTSW 10 88753026 missense probably benign 0.02
R1902:Utp20 UTSW 10 88753026 missense probably benign 0.02
R1967:Utp20 UTSW 10 88816979 missense probably benign 0.03
R2060:Utp20 UTSW 10 88774795 missense probably damaging 0.98
R2102:Utp20 UTSW 10 88772917 missense probably damaging 0.99
R2110:Utp20 UTSW 10 88767451 critical splice donor site probably null
R2115:Utp20 UTSW 10 88786003 missense probably benign 0.02
R2128:Utp20 UTSW 10 88814055 missense probably damaging 0.99
R2129:Utp20 UTSW 10 88814055 missense probably damaging 0.99
R2180:Utp20 UTSW 10 88820939 missense probably damaging 0.98
R2280:Utp20 UTSW 10 88825503 splice site probably null
R2435:Utp20 UTSW 10 88820891 missense possibly damaging 0.89
R2914:Utp20 UTSW 10 88754475 critical splice donor site probably null
R3005:Utp20 UTSW 10 88777455 missense probably damaging 0.97
R3546:Utp20 UTSW 10 88782689 missense probably damaging 1.00
R3547:Utp20 UTSW 10 88782689 missense probably damaging 1.00
R3622:Utp20 UTSW 10 88757993 unclassified probably benign
R3737:Utp20 UTSW 10 88762806 missense probably benign 0.00
R3738:Utp20 UTSW 10 88762806 missense probably benign 0.00
R3841:Utp20 UTSW 10 88775203 unclassified probably benign
R4034:Utp20 UTSW 10 88762806 missense probably benign 0.00
R4035:Utp20 UTSW 10 88762806 missense probably benign 0.00
R4157:Utp20 UTSW 10 88761867 missense probably benign
R4243:Utp20 UTSW 10 88807325 critical splice donor site probably null
R4295:Utp20 UTSW 10 88754519 missense possibly damaging 0.54
R4632:Utp20 UTSW 10 88778261 missense probably damaging 1.00
R4633:Utp20 UTSW 10 88752952 missense probably benign
R4684:Utp20 UTSW 10 88807445 nonsense probably null
R4731:Utp20 UTSW 10 88754520 missense possibly damaging 0.93
R4735:Utp20 UTSW 10 88816918 missense possibly damaging 0.91
R4772:Utp20 UTSW 10 88809935 missense probably benign 0.09
R4912:Utp20 UTSW 10 88771960 missense probably benign 0.01
R4974:Utp20 UTSW 10 88816949 missense probably benign 0.08
R4991:Utp20 UTSW 10 88746934 missense probably benign 0.09
R5004:Utp20 UTSW 10 88748273 missense probably damaging 0.98
R5037:Utp20 UTSW 10 88775330 missense probably benign 0.00
R5043:Utp20 UTSW 10 88798746 missense possibly damaging 0.70
R5108:Utp20 UTSW 10 88768873 missense probably benign 0.00
R5138:Utp20 UTSW 10 88747377 missense probably damaging 0.96
R5252:Utp20 UTSW 10 88750670 missense probably benign 0.01
R5394:Utp20 UTSW 10 88772915 nonsense probably null
R5470:Utp20 UTSW 10 88817896 missense probably benign 0.14
R5558:Utp20 UTSW 10 88751467 missense probably damaging 1.00
R5678:Utp20 UTSW 10 88809117 missense probably benign 0.00
R5822:Utp20 UTSW 10 88817285 missense probably benign 0.00
R5866:Utp20 UTSW 10 88772559 missense possibly damaging 0.82
R5924:Utp20 UTSW 10 88815922 missense probably benign 0.00
R6026:Utp20 UTSW 10 88768679 missense probably benign 0.04
R6363:Utp20 UTSW 10 88757080 missense probably damaging 1.00
R6434:Utp20 UTSW 10 88772533 nonsense probably null
R6477:Utp20 UTSW 10 88768918 missense probably benign 0.05
R6480:Utp20 UTSW 10 88755186 critical splice donor site probably null
R6989:Utp20 UTSW 10 88778240 missense probably benign 0.00
R7033:Utp20 UTSW 10 88754475 critical splice donor site probably null
R7236:Utp20 UTSW 10 88749342 missense probably benign 0.28
R7260:Utp20 UTSW 10 88751472 missense probably benign 0.39
R7296:Utp20 UTSW 10 88770724 missense probably benign 0.21
R7317:Utp20 UTSW 10 88762935 missense possibly damaging 0.83
R7318:Utp20 UTSW 10 88813949 missense possibly damaging 0.89
R7330:Utp20 UTSW 10 88787562 frame shift probably null
R7367:Utp20 UTSW 10 88795443 missense probably benign 0.21
R7432:Utp20 UTSW 10 88798398 missense probably benign 0.00
R7447:Utp20 UTSW 10 88772492 missense probably damaging 1.00
R7473:Utp20 UTSW 10 88820710 splice site probably null
R7520:Utp20 UTSW 10 88818595 missense probably damaging 1.00
R7530:Utp20 UTSW 10 88753006 missense probably damaging 1.00
R7539:Utp20 UTSW 10 88791745 missense probably damaging 1.00
R7651:Utp20 UTSW 10 88754595 missense probably benign 0.41
R7728:Utp20 UTSW 10 88798341 missense probably damaging 1.00
R7831:Utp20 UTSW 10 88762770 nonsense probably null
R7833:Utp20 UTSW 10 88801136 missense possibly damaging 0.92
R7909:Utp20 UTSW 10 88775330 missense probably benign
R7956:Utp20 UTSW 10 88782614 missense probably benign 0.23
R7999:Utp20 UTSW 10 88770388 missense probably benign
R8080:Utp20 UTSW 10 88782715 missense possibly damaging 0.82
R8098:Utp20 UTSW 10 88752948 missense probably benign 0.13
R8104:Utp20 UTSW 10 88757904 missense probably damaging 1.00
R8129:Utp20 UTSW 10 88792625 missense probably benign 0.29
R8147:Utp20 UTSW 10 88758444 missense probably benign 0.02
R8199:Utp20 UTSW 10 88798475 missense probably benign
R8222:Utp20 UTSW 10 88778372 missense probably damaging 1.00
R8415:Utp20 UTSW 10 88826604 critical splice donor site probably null
R8505:Utp20 UTSW 10 88818008 missense probably benign 0.03
RF005:Utp20 UTSW 10 88825457 missense probably damaging 1.00
RF024:Utp20 UTSW 10 88825457 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACGATCACCTTACATGCAAATTTG -3'
(R):5'- ACTGTCACAAGTTTTCTGGGG -3'

Sequencing Primer
(F):5'- CAAATTTGCCTGCTGGTCATGAAG -3'
(R):5'- TCTTTTCTTACAGTGGAAGAAATGG -3'
Posted On2019-06-26