Mutagenetix > Incidental Mutations

Incidental Mutation 'R7192:Usp34'

559664

Institutional Source

Beutler Lab

Gene Symbol

Usp34

Ensembl Gene

ENSMUSG00000056342

Gene Name

ubiquitin specific peptidase 34

Synonyms

Murr2, A530081C03Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.592) question?

Stock #

R7192 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

23306895-23490560 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 23460571 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 2693 (Y2693N)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000130131] [ENSMUST00000180046]

Predicted Effect

probably benign
Transcript: ENSMUST00000130131

SMART Domains

Protein: ENSMUSP00000115168
Gene: ENSMUSG00000056342

Domain	Start	End	E-Value	Type
low complexity region	33	45	N/A	INTRINSIC
Pfam:UCH	171	514	1.1e-48	PFAM
Pfam:UCH_1	172	470	1.6e-25	PFAM
low complexity region	763	785	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000120747
Gene: ENSMUSG00000056342
AA Change: Y2693N

Domain	Start	End	E-Value	Type
low complexity region	489	500	N/A	INTRINSIC
low complexity region	530	544	N/A	INTRINSIC
low complexity region	591	610	N/A	INTRINSIC
coiled coil region	626	671	N/A	INTRINSIC
low complexity region	827	842	N/A	INTRINSIC
low complexity region	1207	1218	N/A	INTRINSIC
low complexity region	1399	1410	N/A	INTRINSIC
low complexity region	1518	1532	N/A	INTRINSIC
low complexity region	1751	1764	N/A	INTRINSIC
low complexity region	1812	1824	N/A	INTRINSIC
Pfam:UCH	1950	2293	7.6e-44	PFAM
Pfam:UCH_1	1951	2249	3.6e-22	PFAM
low complexity region	2542	2564	N/A	INTRINSIC
low complexity region	2672	2679	N/A	INTRINSIC
Blast:Drf_GBD	2943	3116	3e-53	BLAST
low complexity region	3344	3357	N/A	INTRINSIC
coiled coil region	3371	3393	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000180046
AA Change: Y2674N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000137430
Gene: ENSMUSG00000056342
AA Change: Y2674N

Domain	Start	End	E-Value	Type
low complexity region	469	480	N/A	INTRINSIC
low complexity region	510	524	N/A	INTRINSIC
low complexity region	571	590	N/A	INTRINSIC
coiled coil region	607	652	N/A	INTRINSIC
low complexity region	807	822	N/A	INTRINSIC
low complexity region	1187	1198	N/A	INTRINSIC
low complexity region	1379	1390	N/A	INTRINSIC
low complexity region	1498	1512	N/A	INTRINSIC
low complexity region	1731	1744	N/A	INTRINSIC
low complexity region	1792	1804	N/A	INTRINSIC
Pfam:UCH	1930	2273	2.3e-44	PFAM
Pfam:UCH_1	1931	2229	1.1e-22	PFAM
low complexity region	2522	2544	N/A	INTRINSIC
low complexity region	2652	2659	N/A	INTRINSIC
Blast:Drf_GBD	2923	3096	2e-53	BLAST
low complexity region	3324	3337	N/A	INTRINSIC
coiled coil region	3352	3374	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

97% (72/74)

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001O22Rik	G	A	2: 30,796,176	T329I	probably damaging	Het
Actl6a	C	A	3: 32,720,224	P290H	probably damaging	Het
Akap9	T	A	5: 4,005,723		probably null	Het
Bach1	C	T	16: 87,729,663	S671L	possibly damaging	Het
Cacna1c	T	C	6: 118,656,249	I1099V		Het
Cage1	G	T	13: 38,019,244	P615T	probably benign	Het
Caskin2	C	A	11: 115,801,376	R861L	probably damaging	Het
Cc2d2b	A	G	19: 40,774,437	T386A	unknown	Het
Ccndbp1	A	G	2: 121,012,943	D272G	probably damaging	Het
Cep192	T	A	18: 67,850,528	V1553E	probably damaging	Het
Chrm5	C	T	2: 112,480,327	G148D	probably damaging	Het
Cntnap4	T	C	8: 112,881,800	V1284A	probably benign	Het
Cpd	T	C	11: 76,814,841	Y355C	probably damaging	Het
Csmd3	C	T	15: 47,704,237	V1266I		Het
Cyfip2	T	C	11: 46,254,666	E609G	probably benign	Het
Dbr1	T	C	9: 99,576,702		probably null	Het
Dmxl1	T	C	18: 49,955,853	Y2800H	probably damaging	Het
Dnajc6	G	T	4: 101,597,803	A64S	probably benign	Het
Dpp8	A	T	9: 65,045,786	N248I	possibly damaging	Het
Dsp	A	T	13: 38,195,593	I2105F	probably benign	Het
Edem1	G	A	6: 108,829,004	V89M	probably benign	Het
Eml4	A	G	17: 83,454,461	Q528R	probably benign	Het
Epb42	A	T	2: 121,024,097	V669D	unknown	Het
Fat4	A	T	3: 38,980,464	Q2755L	probably benign	Het
Gata6	A	G	18: 11,054,475	K135E	possibly damaging	Het
Gm36079	T	A	13: 120,026,705	K103*	probably null	Het
Gm4788	T	A	1: 139,739,295	H414L	probably damaging	Het
Gmeb1	A	T	4: 132,227,890	F325I	probably benign	Het
H2-M10.3	C	T	17: 36,366,559	E276K	probably damaging	Het
Hist1h4m	A	T	13: 21,812,057	K92*	probably null	Het
Ifi207	T	C	1: 173,729,018	N718S	not run	Het
Il6st	A	G	13: 112,495,207	N427D	probably benign	Het
Kat7	T	A	11: 95,275,830	M509L	probably benign	Het
Klk1b4	T	C	7: 44,209,621	V21A	probably benign	Het
Malt1	T	A	18: 65,437,827	L78Q	probably benign	Het
Mertk	A	G	2: 128,793,108		probably null	Het
Myo1b	A	G	1: 51,757,217	L1016P	probably damaging	Het
Neu4	A	G	1: 94,025,141	I411V	probably benign	Het
Nutm2	A	T	13: 50,473,069	D420V	probably damaging	Het
Olfr1364	A	G	13: 21,574,369	L29P	probably damaging	Het
Olfr1404	T	A	1: 173,216,008	M119K	probably damaging	Het
Olfr206	T	C	16: 59,345,179	D174G	probably benign	Het
Olfr728	T	C	14: 50,140,120	E173G	possibly damaging	Het
Pcdha12	C	T	18: 37,020,263	R12W	probably benign	Het
Pdgfra	G	T	5: 75,183,106	D763Y	probably damaging	Het
Pkd2	T	C	5: 104,486,657	V518A	probably benign	Het
Prb1	G	T	6: 132,207,372	P433T	unknown	Het
Ptrh2	A	G	11: 86,690,009	T151A	probably damaging	Het
Qars	T	A	9: 108,511,561	N273K	probably damaging	Het
Robo2	T	C	16: 73,920,750	Y1154C	probably benign	Het
Rps6kc1	T	A	1: 190,800,359	D482V	probably damaging	Het
Sec16b	T	C	1: 157,529,443	S74P	probably benign	Het
Serpinb2	A	T	1: 107,524,576	I295F	probably damaging	Het
Sh3pxd2b	T	A	11: 32,414,318	D301E	probably damaging	Het
Sipa1l2	G	A	8: 125,422,609	T1637I	probably benign	Het
Slc27a4	A	T	2: 29,805,929	N159Y	probably damaging	Het
Stat1	A	C	1: 52,135,621	K161Q	possibly damaging	Het
Stc2	T	C	11: 31,369,872		probably benign	Het
Strip1	A	G	3: 107,615,335	W681R	possibly damaging	Het
Sv2a	G	A	3: 96,193,746	G687S	probably damaging	Het
Thnsl2	C	T	6: 71,139,755	V138I	probably benign	Het
Tmco3	G	A	8: 13,319,605		probably null	Het
Tnfrsf1a	T	C	6: 125,361,596	S235P	unknown	Het
Tpbg	T	A	9: 85,844,032	L18*	probably null	Het
Trabd2b	A	T	4: 114,610,020	Q482L	possibly damaging	Het
Trim35	T	A	14: 66,297,446	F126Y	probably damaging	Het
Ttn	A	T	2: 76,827,944	V12364D	unknown	Het
Ubac2	A	G	14: 121,973,716	Y166C	probably damaging	Het
Unc13b	T	A	4: 43,258,519	V1320D	probably damaging	Het
Utp20	A	T	10: 88,772,459	M1572K	probably benign	Het
Vmn1r7	C	T	6: 57,024,467	M269I	probably benign	Het
Vmn2r3	C	T	3: 64,259,943	G589D	probably benign	Het
Vrtn	A	T	12: 84,648,862	M129L	probably damaging	Het
Zfp273	A	T	13: 67,825,064	T104S	possibly damaging	Het
Zfp384	T	A	6: 125,033,312	N390K	probably damaging	Het
Znfx1	A	G	2: 167,042,190	M933T	probably benign	Het

Other mutations in Usp34

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL00477:Usp34	APN	11	23468879	missense	probably damaging	0.99
IGL01307:Usp34	APN	11	23417676	missense	probably damaging	0.99
IGL01313:Usp34	APN	11	23473206	missense	probably damaging	1.00
IGL01794:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01826:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01827:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01830:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01867:Usp34	APN	11	23384411	missense	possibly damaging	0.77
IGL01939:Usp34	APN	11	23345141	splice site	probably benign
IGL01977:Usp34	APN	11	23452661	missense	probably damaging	1.00
IGL01985:Usp34	APN	11	23452565	missense	probably damaging	1.00
IGL02011:Usp34	APN	11	23471554	missense	probably damaging	0.99
IGL02302:Usp34	APN	11	23467243	missense	possibly damaging	0.91
IGL02423:Usp34	APN	11	23354900	missense	probably benign	0.11
IGL02491:Usp34	APN	11	23432630	missense	probably damaging	0.98
IGL02532:Usp34	APN	11	23370291	missense	probably damaging	0.99
IGL02561:Usp34	APN	11	23351652	missense	probably benign	0.09
IGL02706:Usp34	APN	11	23388659	splice site	probably benign
IGL02891:Usp34	APN	11	23487166	missense	probably benign	0.09
IGL03079:Usp34	APN	11	23432247	missense	possibly damaging	0.48
IGL03089:Usp34	APN	11	23446958	missense	possibly damaging	0.84
IGL03175:Usp34	APN	11	23488686	missense	probably benign
IGL03256:Usp34	APN	11	23420090	nonsense	probably null
IGL03280:Usp34	APN	11	23354897	missense	probably damaging	1.00
IGL03289:Usp34	APN	11	23393818	missense	possibly damaging	0.94
IGL03408:Usp34	APN	11	23446957	missense	possibly damaging	0.92
Chub	UTSW	11	23464686	missense	probably damaging	0.99
Cicione	UTSW	11	23489033	missense	possibly damaging	0.85
I2288:Usp34	UTSW	11	23432473	splice site	probably benign
R0047:Usp34	UTSW	11	23464403	missense	probably benign	0.34
R0047:Usp34	UTSW	11	23464403	missense	probably benign	0.34
R0099:Usp34	UTSW	11	23363111	missense	probably damaging	1.00
R0240:Usp34	UTSW	11	23433206	missense	probably damaging	0.99
R0240:Usp34	UTSW	11	23433206	missense	probably damaging	0.99
R0403:Usp34	UTSW	11	23333838	missense	possibly damaging	0.82
R0432:Usp34	UTSW	11	23401505	missense	probably damaging	0.99
R0446:Usp34	UTSW	11	23467207	missense	probably damaging	0.97
R0455:Usp34	UTSW	11	23446741	splice site	probably benign
R0470:Usp34	UTSW	11	23436001	missense	possibly damaging	0.94
R0472:Usp34	UTSW	11	23384509	splice site	probably benign
R0512:Usp34	UTSW	11	23451997	missense	probably benign	0.04
R0557:Usp34	UTSW	11	23403848	missense	probably damaging	0.98
R0562:Usp34	UTSW	11	23432406	splice site	probably benign
R0656:Usp34	UTSW	11	23472967	missense	probably damaging	0.99
R0693:Usp34	UTSW	11	23452637	missense	probably damaging	0.97
R0739:Usp34	UTSW	11	23467243	missense	possibly damaging	0.91
R1061:Usp34	UTSW	11	23384420	missense	possibly damaging	0.51
R1078:Usp34	UTSW	11	23433175	splice site	probably benign
R1223:Usp34	UTSW	11	23446464	synonymous	probably null
R1295:Usp34	UTSW	11	23384477	missense	probably damaging	1.00
R1430:Usp34	UTSW	11	23459151	missense	probably damaging	0.97
R1445:Usp34	UTSW	11	23351629	missense	probably damaging	0.99
R1468:Usp34	UTSW	11	23441171	missense	probably damaging	1.00
R1468:Usp34	UTSW	11	23441171	missense	probably damaging	1.00
R1471:Usp34	UTSW	11	23488862	missense	probably benign	0.20
R1475:Usp34	UTSW	11	23473253	missense	probably damaging	0.99
R1628:Usp34	UTSW	11	23488725	missense	probably damaging	1.00
R1631:Usp34	UTSW	11	23460651	missense	probably damaging	0.99
R1655:Usp34	UTSW	11	23375051	missense	probably benign	0.05
R1741:Usp34	UTSW	11	23364103	missense	probably benign	0.00
R1854:Usp34	UTSW	11	23426153	missense	probably benign	0.24
R1867:Usp34	UTSW	11	23361593	missense	possibly damaging	0.82
R1869:Usp34	UTSW	11	23364479	missense	probably benign	0.37
R1870:Usp34	UTSW	11	23364479	missense	probably benign	0.37
R1871:Usp34	UTSW	11	23364479	missense	probably benign	0.37
R1967:Usp34	UTSW	11	23364503	missense	probably benign	0.01
R2051:Usp34	UTSW	11	23464468	missense	probably damaging	0.97
R2132:Usp34	UTSW	11	23464556	missense	possibly damaging	0.95
R2156:Usp34	UTSW	11	23382602	missense	probably damaging	0.98
R2205:Usp34	UTSW	11	23385147	missense	probably damaging	0.97
R2342:Usp34	UTSW	11	23403599	missense	possibly damaging	0.46
R3431:Usp34	UTSW	11	23370466	missense	possibly damaging	0.95
R3812:Usp34	UTSW	11	23464517	missense	possibly damaging	0.94
R3872:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3873:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3874:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3875:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3925:Usp34	UTSW	11	23343640	missense	probably benign	0.28
R3972:Usp34	UTSW	11	23457803	missense	probably damaging	1.00
R4018:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R4042:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R4155:Usp34	UTSW	11	23417676	missense	probably damaging	0.99
R4197:Usp34	UTSW	11	23444189	missense	probably damaging	0.98
R4352:Usp34	UTSW	11	23320727	missense	possibly damaging	0.73
R4379:Usp34	UTSW	11	23384499	missense	possibly damaging	0.52
R4444:Usp34	UTSW	11	23435998	missense	probably damaging	0.98
R4475:Usp34	UTSW	11	23457975	missense	possibly damaging	0.95
R4501:Usp34	UTSW	11	23401529	missense	probably damaging	1.00
R4527:Usp34	UTSW	11	23421257	missense	possibly damaging	0.57
R4603:Usp34	UTSW	11	23464633	missense	probably damaging	0.97
R4612:Usp34	UTSW	11	23432268	missense	probably damaging	0.99
R4673:Usp34	UTSW	11	23364480	small deletion	probably benign
R4707:Usp34	UTSW	11	23487215	missense	probably damaging	1.00
R4736:Usp34	UTSW	11	23393749	splice site	probably null
R4867:Usp34	UTSW	11	23451999	missense	probably benign	0.28
R4879:Usp34	UTSW	11	23373410	missense	possibly damaging	0.94
R4977:Usp34	UTSW	11	23488982	missense	probably damaging	1.00
R5004:Usp34	UTSW	11	23464586	missense	probably damaging	1.00
R5057:Usp34	UTSW	11	23458086	intron	probably benign
R5068:Usp34	UTSW	11	23460665	missense	possibly damaging	0.94
R5304:Usp34	UTSW	11	23343616	missense	probably damaging	1.00
R5320:Usp34	UTSW	11	23333739	missense	probably benign
R5327:Usp34	UTSW	11	23468846	missense	probably damaging	1.00
R5328:Usp34	UTSW	11	23464616	missense	probably benign	0.01
R5328:Usp34	UTSW	11	23488659	missense	probably benign	0.04
R5390:Usp34	UTSW	11	23444202	critical splice donor site	probably null
R5434:Usp34	UTSW	11	23412271	missense	probably damaging	0.99
R5523:Usp34	UTSW	11	23349198	missense	probably benign	0.39
R5567:Usp34	UTSW	11	23488336	missense	probably damaging	0.97
R5571:Usp34	UTSW	11	23457975	missense	probably damaging	0.99
R5645:Usp34	UTSW	11	23375024	missense	possibly damaging	0.86
R5713:Usp34	UTSW	11	23343515	missense	possibly damaging	0.94
R5719:Usp34	UTSW	11	23354846	missense	probably benign	0.00
R5813:Usp34	UTSW	11	23421340	missense	probably benign	0.38
R5921:Usp34	UTSW	11	23464686	missense	probably damaging	0.99
R5928:Usp34	UTSW	11	23436040	missense	probably damaging	0.98
R5944:Usp34	UTSW	11	23363089	missense	probably damaging	1.00
R6198:Usp34	UTSW	11	23484127	missense	probably damaging	1.00
R6229:Usp34	UTSW	11	23446778	missense	probably damaging	0.99
R6306:Usp34	UTSW	11	23412260	missense	possibly damaging	0.94
R6320:Usp34	UTSW	11	23452520	missense	probably damaging	0.98
R6341:Usp34	UTSW	11	23381353	missense	probably damaging	0.97
R6374:Usp34	UTSW	11	23438914	missense	probably damaging	1.00
R6398:Usp34	UTSW	11	23488666	missense	probably benign
R6438:Usp34	UTSW	11	23364266	missense	probably benign	0.02
R6668:Usp34	UTSW	11	23460659	missense	probably damaging	0.97
R6700:Usp34	UTSW	11	23439011	missense	probably damaging	1.00
R6783:Usp34	UTSW	11	23412318	missense	probably damaging	1.00
R6821:Usp34	UTSW	11	23367491	missense	possibly damaging	0.79
R6855:Usp34	UTSW	11	23452569	missense	possibly damaging	0.94
R6916:Usp34	UTSW	11	23458023	missense	probably damaging	0.98
R7020:Usp34	UTSW	11	23393954	missense	probably benign	0.05
R7026:Usp34	UTSW	11	23361622	missense	probably damaging	1.00
R7085:Usp34	UTSW	11	23363097	missense
R7101:Usp34	UTSW	11	23426183	missense
R7168:Usp34	UTSW	11	23464585	missense
R7264:Usp34	UTSW	11	23333566	missense	probably benign	0.00
R7325:Usp34	UTSW	11	23419052	missense
R7343:Usp34	UTSW	11	23488868	missense
R7358:Usp34	UTSW	11	23361683	missense	probably damaging	0.99
R7369:Usp34	UTSW	11	23432361	missense
R7389:Usp34	UTSW	11	23345200	missense
R7459:Usp34	UTSW	11	23364458	missense	possibly damaging	0.53
R7517:Usp34	UTSW	11	23446968	missense
R7729:Usp34	UTSW	11	23449268	missense
X0023:Usp34	UTSW	11	23375028	missense	possibly damaging	0.73
X0057:Usp34	UTSW	11	23457824	missense	possibly damaging	0.86

Predicted Primers

PCR Primer
(F):5'- GTCCACTGGAATCTTGTTTTCG -3'
(R):5'- AGGCATTATCATTGGGTTACCC -3'

Sequencing Primer
(F):5'- TAGTTTCAGGGGAGCTGACACC -3'
(R):5'- CTCTCCCAAAACCCTAAAAATCG -3'

Posted On

2019-06-26