Incidental Mutation 'R7192:Usp34'
ID 559664
Institutional Source Beutler Lab
Gene Symbol Usp34
Ensembl Gene ENSMUSG00000056342
Gene Name ubiquitin specific peptidase 34
Synonyms Murr2, A530081C03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.671) question?
Stock # R7192 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 23306895-23490560 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 23460571 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 2693 (Y2693N)
Gene Model predicted gene model for transcript(s): [ENSMUST00000130131] [ENSMUST00000180046]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000130131
SMART Domains Protein: ENSMUSP00000115168
Gene: ENSMUSG00000056342

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
Pfam:UCH 171 514 1.1e-48 PFAM
Pfam:UCH_1 172 470 1.6e-25 PFAM
low complexity region 763 785 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000120747
Gene: ENSMUSG00000056342
AA Change: Y2693N

DomainStartEndE-ValueType
low complexity region 489 500 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 591 610 N/A INTRINSIC
coiled coil region 626 671 N/A INTRINSIC
low complexity region 827 842 N/A INTRINSIC
low complexity region 1207 1218 N/A INTRINSIC
low complexity region 1399 1410 N/A INTRINSIC
low complexity region 1518 1532 N/A INTRINSIC
low complexity region 1751 1764 N/A INTRINSIC
low complexity region 1812 1824 N/A INTRINSIC
Pfam:UCH 1950 2293 7.6e-44 PFAM
Pfam:UCH_1 1951 2249 3.6e-22 PFAM
low complexity region 2542 2564 N/A INTRINSIC
low complexity region 2672 2679 N/A INTRINSIC
Blast:Drf_GBD 2943 3116 3e-53 BLAST
low complexity region 3344 3357 N/A INTRINSIC
coiled coil region 3371 3393 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000180046
AA Change: Y2674N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000137430
Gene: ENSMUSG00000056342
AA Change: Y2674N

DomainStartEndE-ValueType
low complexity region 469 480 N/A INTRINSIC
low complexity region 510 524 N/A INTRINSIC
low complexity region 571 590 N/A INTRINSIC
coiled coil region 607 652 N/A INTRINSIC
low complexity region 807 822 N/A INTRINSIC
low complexity region 1187 1198 N/A INTRINSIC
low complexity region 1379 1390 N/A INTRINSIC
low complexity region 1498 1512 N/A INTRINSIC
low complexity region 1731 1744 N/A INTRINSIC
low complexity region 1792 1804 N/A INTRINSIC
Pfam:UCH 1930 2273 2.3e-44 PFAM
Pfam:UCH_1 1931 2229 1.1e-22 PFAM
low complexity region 2522 2544 N/A INTRINSIC
low complexity region 2652 2659 N/A INTRINSIC
Blast:Drf_GBD 2923 3096 2e-53 BLAST
low complexity region 3324 3337 N/A INTRINSIC
coiled coil region 3352 3374 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (72/74)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik G A 2: 30,796,176 T329I probably damaging Het
Actl6a C A 3: 32,720,224 P290H probably damaging Het
Akap9 T A 5: 4,005,723 probably null Het
Bach1 C T 16: 87,729,663 S671L possibly damaging Het
Cacna1c T C 6: 118,656,249 I1099V Het
Cage1 G T 13: 38,019,244 P615T probably benign Het
Caskin2 C A 11: 115,801,376 R861L probably damaging Het
Cc2d2b A G 19: 40,774,437 T386A unknown Het
Ccndbp1 A G 2: 121,012,943 D272G probably damaging Het
Cep192 T A 18: 67,850,528 V1553E probably damaging Het
Chrm5 C T 2: 112,480,327 G148D probably damaging Het
Cntnap4 T C 8: 112,881,800 V1284A probably benign Het
Cpd T C 11: 76,814,841 Y355C probably damaging Het
Csmd3 C T 15: 47,704,237 V1266I Het
Cyfip2 T C 11: 46,254,666 E609G probably benign Het
Dbr1 T C 9: 99,576,702 probably null Het
Dmxl1 T C 18: 49,955,853 Y2800H probably damaging Het
Dnajc6 G T 4: 101,597,803 A64S probably benign Het
Dpp8 A T 9: 65,045,786 N248I possibly damaging Het
Dsp A T 13: 38,195,593 I2105F probably benign Het
Edem1 G A 6: 108,829,004 V89M probably benign Het
Eml4 A G 17: 83,454,461 Q528R probably benign Het
Epb42 A T 2: 121,024,097 V669D unknown Het
Fat4 A T 3: 38,980,464 Q2755L probably benign Het
Gata6 A G 18: 11,054,475 K135E possibly damaging Het
Gm36079 T A 13: 120,026,705 K103* probably null Het
Gm4788 T A 1: 139,739,295 H414L probably damaging Het
Gmeb1 A T 4: 132,227,890 F325I probably benign Het
H2-M10.3 C T 17: 36,366,559 E276K probably damaging Het
Hist1h4m A T 13: 21,812,057 K92* probably null Het
Ifi207 T C 1: 173,729,018 N718S not run Het
Il6st A G 13: 112,495,207 N427D probably benign Het
Kat7 T A 11: 95,275,830 M509L probably benign Het
Klk1b4 T C 7: 44,209,621 V21A probably benign Het
Malt1 T A 18: 65,437,827 L78Q probably benign Het
Mertk A G 2: 128,793,108 probably null Het
Myo1b A G 1: 51,757,217 L1016P probably damaging Het
Neu4 A G 1: 94,025,141 I411V probably benign Het
Nutm2 A T 13: 50,473,069 D420V probably damaging Het
Olfr1364 A G 13: 21,574,369 L29P probably damaging Het
Olfr1404 T A 1: 173,216,008 M119K probably damaging Het
Olfr206 T C 16: 59,345,179 D174G probably benign Het
Olfr728 T C 14: 50,140,120 E173G possibly damaging Het
Pcdha12 C T 18: 37,020,263 R12W probably benign Het
Pdgfra G T 5: 75,183,106 D763Y probably damaging Het
Pkd2 T C 5: 104,486,657 V518A probably benign Het
Prb1 G T 6: 132,207,372 P433T unknown Het
Ptrh2 A G 11: 86,690,009 T151A probably damaging Het
Qars T A 9: 108,511,561 N273K probably damaging Het
Robo2 T C 16: 73,920,750 Y1154C probably benign Het
Rps6kc1 T A 1: 190,800,359 D482V probably damaging Het
Sec16b T C 1: 157,529,443 S74P probably benign Het
Serpinb2 A T 1: 107,524,576 I295F probably damaging Het
Sh3pxd2b T A 11: 32,414,318 D301E probably damaging Het
Sipa1l2 G A 8: 125,422,609 T1637I probably benign Het
Slc27a4 A T 2: 29,805,929 N159Y probably damaging Het
Stat1 A C 1: 52,135,621 K161Q possibly damaging Het
Stc2 T C 11: 31,369,872 probably benign Het
Strip1 A G 3: 107,615,335 W681R possibly damaging Het
Sv2a G A 3: 96,193,746 G687S probably damaging Het
Thnsl2 C T 6: 71,139,755 V138I probably benign Het
Tmco3 G A 8: 13,319,605 probably null Het
Tnfrsf1a T C 6: 125,361,596 S235P unknown Het
Tpbg T A 9: 85,844,032 L18* probably null Het
Trabd2b A T 4: 114,610,020 Q482L possibly damaging Het
Trim35 T A 14: 66,297,446 F126Y probably damaging Het
Ttn A T 2: 76,827,944 V12364D unknown Het
Ubac2 A G 14: 121,973,716 Y166C probably damaging Het
Unc13b T A 4: 43,258,519 V1320D probably damaging Het
Utp20 A T 10: 88,772,459 M1572K probably benign Het
Vmn1r7 C T 6: 57,024,467 M269I probably benign Het
Vmn2r3 C T 3: 64,259,943 G589D probably benign Het
Vrtn A T 12: 84,648,862 M129L probably damaging Het
Zfp273 A T 13: 67,825,064 T104S possibly damaging Het
Zfp384 T A 6: 125,033,312 N390K probably damaging Het
Znfx1 A G 2: 167,042,190 M933T probably benign Het
Other mutations in Usp34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Usp34 APN 11 23436020 missense probably damaging 0.98
IGL00477:Usp34 APN 11 23468879 missense probably damaging 0.99
IGL01307:Usp34 APN 11 23417676 missense probably damaging 0.99
IGL01313:Usp34 APN 11 23473206 missense probably damaging 1.00
IGL01794:Usp34 APN 11 23436020 missense probably damaging 0.98
IGL01826:Usp34 APN 11 23436020 missense probably damaging 0.98
IGL01827:Usp34 APN 11 23436020 missense probably damaging 0.98
IGL01830:Usp34 APN 11 23436020 missense probably damaging 0.98
IGL01867:Usp34 APN 11 23384411 missense possibly damaging 0.77
IGL01939:Usp34 APN 11 23345141 splice site probably benign
IGL01977:Usp34 APN 11 23452661 missense probably damaging 1.00
IGL01985:Usp34 APN 11 23452565 missense probably damaging 1.00
IGL02011:Usp34 APN 11 23471554 missense probably damaging 0.99
IGL02302:Usp34 APN 11 23467243 missense possibly damaging 0.91
IGL02423:Usp34 APN 11 23354900 missense probably benign 0.11
IGL02491:Usp34 APN 11 23432630 missense probably damaging 0.98
IGL02532:Usp34 APN 11 23370291 missense probably damaging 0.99
IGL02561:Usp34 APN 11 23351652 missense probably benign 0.09
IGL02706:Usp34 APN 11 23388659 splice site probably benign
IGL02891:Usp34 APN 11 23487166 missense probably benign 0.09
IGL03079:Usp34 APN 11 23432247 missense possibly damaging 0.48
IGL03089:Usp34 APN 11 23446958 missense possibly damaging 0.84
IGL03175:Usp34 APN 11 23488686 missense probably benign
IGL03256:Usp34 APN 11 23420090 nonsense probably null
IGL03280:Usp34 APN 11 23354897 missense probably damaging 1.00
IGL03289:Usp34 APN 11 23393818 missense possibly damaging 0.94
IGL03408:Usp34 APN 11 23446957 missense possibly damaging 0.92
Chub UTSW 11 23464686 missense probably damaging 0.99
Cicione UTSW 11 23489033 missense possibly damaging 0.85
R5571_Usp34_680 UTSW 11 23457975 missense probably damaging 0.99
R5713_Usp34_003 UTSW 11 23343515 missense possibly damaging 0.94
Roebuck UTSW 11 23486810 splice site probably benign
stoat UTSW 11 23487203 missense
tunnelvision UTSW 11 23446968 missense
I2288:Usp34 UTSW 11 23432473 splice site probably benign
R0047:Usp34 UTSW 11 23464403 missense probably benign 0.34
R0047:Usp34 UTSW 11 23464403 missense probably benign 0.34
R0099:Usp34 UTSW 11 23363111 missense probably damaging 1.00
R0240:Usp34 UTSW 11 23433206 missense probably damaging 0.99
R0240:Usp34 UTSW 11 23433206 missense probably damaging 0.99
R0403:Usp34 UTSW 11 23333838 missense possibly damaging 0.82
R0432:Usp34 UTSW 11 23401505 missense probably damaging 0.99
R0446:Usp34 UTSW 11 23467207 missense probably damaging 0.97
R0455:Usp34 UTSW 11 23446741 splice site probably benign
R0470:Usp34 UTSW 11 23436001 missense possibly damaging 0.94
R0472:Usp34 UTSW 11 23384509 splice site probably benign
R0512:Usp34 UTSW 11 23451997 missense probably benign 0.04
R0557:Usp34 UTSW 11 23403848 missense probably damaging 0.98
R0562:Usp34 UTSW 11 23432406 splice site probably benign
R0656:Usp34 UTSW 11 23472967 missense probably damaging 0.99
R0693:Usp34 UTSW 11 23452637 missense probably damaging 0.97
R0739:Usp34 UTSW 11 23467243 missense possibly damaging 0.91
R1061:Usp34 UTSW 11 23384420 missense possibly damaging 0.51
R1078:Usp34 UTSW 11 23433175 splice site probably benign
R1223:Usp34 UTSW 11 23446464 splice site probably null
R1295:Usp34 UTSW 11 23384477 missense probably damaging 1.00
R1430:Usp34 UTSW 11 23459151 missense probably damaging 0.97
R1445:Usp34 UTSW 11 23351629 missense probably damaging 0.99
R1468:Usp34 UTSW 11 23441171 missense probably damaging 1.00
R1468:Usp34 UTSW 11 23441171 missense probably damaging 1.00
R1471:Usp34 UTSW 11 23488862 missense probably benign 0.20
R1475:Usp34 UTSW 11 23473253 missense probably damaging 0.99
R1628:Usp34 UTSW 11 23488725 missense probably damaging 1.00
R1631:Usp34 UTSW 11 23460651 missense probably damaging 0.99
R1655:Usp34 UTSW 11 23375051 missense probably benign 0.05
R1741:Usp34 UTSW 11 23364103 missense probably benign 0.00
R1854:Usp34 UTSW 11 23426153 missense probably benign 0.24
R1867:Usp34 UTSW 11 23361593 missense possibly damaging 0.82
R1869:Usp34 UTSW 11 23364479 missense probably benign 0.37
R1870:Usp34 UTSW 11 23364479 missense probably benign 0.37
R1871:Usp34 UTSW 11 23364479 missense probably benign 0.37
R1967:Usp34 UTSW 11 23364503 missense probably benign 0.01
R2051:Usp34 UTSW 11 23464468 missense probably damaging 0.97
R2132:Usp34 UTSW 11 23464556 missense possibly damaging 0.95
R2156:Usp34 UTSW 11 23382602 missense probably damaging 0.98
R2205:Usp34 UTSW 11 23385147 missense probably damaging 0.97
R2342:Usp34 UTSW 11 23403599 missense possibly damaging 0.46
R3431:Usp34 UTSW 11 23370466 missense possibly damaging 0.95
R3812:Usp34 UTSW 11 23464517 missense possibly damaging 0.94
R3872:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R3873:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R3874:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R3875:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R3925:Usp34 UTSW 11 23343640 missense probably benign 0.28
R3972:Usp34 UTSW 11 23457803 missense probably damaging 1.00
R4018:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R4042:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R4155:Usp34 UTSW 11 23417676 missense probably damaging 0.99
R4197:Usp34 UTSW 11 23444189 missense probably damaging 0.98
R4352:Usp34 UTSW 11 23320727 missense possibly damaging 0.73
R4379:Usp34 UTSW 11 23384499 missense possibly damaging 0.52
R4444:Usp34 UTSW 11 23435998 missense probably damaging 0.98
R4475:Usp34 UTSW 11 23457975 missense possibly damaging 0.95
R4501:Usp34 UTSW 11 23401529 missense probably damaging 1.00
R4527:Usp34 UTSW 11 23421257 missense possibly damaging 0.57
R4603:Usp34 UTSW 11 23464633 missense probably damaging 0.97
R4612:Usp34 UTSW 11 23432268 missense probably damaging 0.99
R4673:Usp34 UTSW 11 23364480 small deletion probably benign
R4707:Usp34 UTSW 11 23487215 missense probably damaging 1.00
R4736:Usp34 UTSW 11 23393749 splice site probably null
R4867:Usp34 UTSW 11 23451999 missense probably benign 0.28
R4879:Usp34 UTSW 11 23373410 missense possibly damaging 0.94
R4977:Usp34 UTSW 11 23488982 missense probably damaging 1.00
R5004:Usp34 UTSW 11 23464586 missense probably damaging 1.00
R5057:Usp34 UTSW 11 23458086 intron probably benign
R5068:Usp34 UTSW 11 23460665 missense possibly damaging 0.94
R5304:Usp34 UTSW 11 23343616 missense probably damaging 1.00
R5320:Usp34 UTSW 11 23333739 missense probably benign
R5327:Usp34 UTSW 11 23468846 missense probably damaging 1.00
R5328:Usp34 UTSW 11 23464616 missense probably benign 0.01
R5328:Usp34 UTSW 11 23488659 missense probably benign 0.04
R5390:Usp34 UTSW 11 23444202 critical splice donor site probably null
R5434:Usp34 UTSW 11 23412271 missense probably damaging 0.99
R5523:Usp34 UTSW 11 23349198 missense probably benign 0.39
R5567:Usp34 UTSW 11 23488336 missense probably damaging 0.97
R5571:Usp34 UTSW 11 23457975 missense probably damaging 0.99
R5645:Usp34 UTSW 11 23375024 missense possibly damaging 0.86
R5713:Usp34 UTSW 11 23343515 missense possibly damaging 0.94
R5719:Usp34 UTSW 11 23354846 missense probably benign 0.00
R5813:Usp34 UTSW 11 23421340 missense probably benign 0.38
R5921:Usp34 UTSW 11 23464686 missense probably damaging 0.99
R5928:Usp34 UTSW 11 23436040 missense probably damaging 0.98
R5944:Usp34 UTSW 11 23363089 missense probably damaging 1.00
R6198:Usp34 UTSW 11 23484127 missense probably damaging 1.00
R6229:Usp34 UTSW 11 23446778 missense probably damaging 0.99
R6306:Usp34 UTSW 11 23412260 missense possibly damaging 0.94
R6320:Usp34 UTSW 11 23452520 missense probably damaging 0.98
R6341:Usp34 UTSW 11 23381353 missense probably damaging 0.97
R6374:Usp34 UTSW 11 23438914 missense probably damaging 1.00
R6398:Usp34 UTSW 11 23488666 missense probably benign
R6438:Usp34 UTSW 11 23364266 missense probably benign 0.02
R6668:Usp34 UTSW 11 23460659 missense probably damaging 0.97
R6700:Usp34 UTSW 11 23439011 missense probably damaging 1.00
R6783:Usp34 UTSW 11 23412318 missense probably damaging 1.00
R6821:Usp34 UTSW 11 23367491 missense possibly damaging 0.79
R6855:Usp34 UTSW 11 23452569 missense possibly damaging 0.94
R6916:Usp34 UTSW 11 23458023 missense probably damaging 0.98
R7020:Usp34 UTSW 11 23393954 missense probably benign 0.05
R7026:Usp34 UTSW 11 23361622 missense probably damaging 1.00
R7085:Usp34 UTSW 11 23363097 missense
R7101:Usp34 UTSW 11 23426183 missense
R7168:Usp34 UTSW 11 23464585 missense
R7264:Usp34 UTSW 11 23333566 missense probably benign 0.00
R7325:Usp34 UTSW 11 23419052 missense
R7343:Usp34 UTSW 11 23488868 missense
R7358:Usp34 UTSW 11 23361683 missense probably damaging 0.99
R7369:Usp34 UTSW 11 23432361 missense
R7389:Usp34 UTSW 11 23345200 missense
R7459:Usp34 UTSW 11 23364458 missense possibly damaging 0.53
R7517:Usp34 UTSW 11 23446968 missense
R7729:Usp34 UTSW 11 23449268 missense
R7777:Usp34 UTSW 11 23382638 missense
R7810:Usp34 UTSW 11 23412314 missense
R7836:Usp34 UTSW 11 23446614 missense
R7862:Usp34 UTSW 11 23464718 missense
R7993:Usp34 UTSW 11 23377622 missense
R8050:Usp34 UTSW 11 23446787 missense
R8054:Usp34 UTSW 11 23361295 missense
R8239:Usp34 UTSW 11 23446750 missense
R8266:Usp34 UTSW 11 23486810 splice site probably benign
R8347:Usp34 UTSW 11 23412345 missense
R8409:Usp34 UTSW 11 23457811 missense
R8692:Usp34 UTSW 11 23429325 missense
R8694:Usp34 UTSW 11 23484161 missense
R8734:Usp34 UTSW 11 23444184 missense
R8806:Usp34 UTSW 11 23484143 missense
R8914:Usp34 UTSW 11 23343604 missense
R8987:Usp34 UTSW 11 23464267 missense
R9013:Usp34 UTSW 11 23370302 missense
R9108:Usp34 UTSW 11 23370528 missense
R9264:Usp34 UTSW 11 23489064 missense
R9301:Usp34 UTSW 11 23472951 missense
R9375:Usp34 UTSW 11 23487203 missense
R9385:Usp34 UTSW 11 23449223 missense
R9500:Usp34 UTSW 11 23381337 missense probably damaging 0.99
R9566:Usp34 UTSW 11 23367529 missense
R9629:Usp34 UTSW 11 23364364 missense
R9679:Usp34 UTSW 11 23444369 missense
R9680:Usp34 UTSW 11 23367385 missense possibly damaging 0.94
R9686:Usp34 UTSW 11 23474351 missense
R9752:Usp34 UTSW 11 23459182 missense probably benign 0.11
X0023:Usp34 UTSW 11 23375028 missense possibly damaging 0.73
X0057:Usp34 UTSW 11 23457824 missense possibly damaging 0.86
Z1176:Usp34 UTSW 11 23473221 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCACTGGAATCTTGTTTTCG -3'
(R):5'- AGGCATTATCATTGGGTTACCC -3'

Sequencing Primer
(F):5'- TAGTTTCAGGGGAGCTGACACC -3'
(R):5'- CTCTCCCAAAACCCTAAAAATCG -3'
Posted On 2019-06-26